This is a test version of Biostars. For the public version, visit https://www.biostars.org.
C Programing In Bioinformatics

how to find the number of codons in a sequence by c programing

c programming

Dear ankita: The way the question is currently posed, noone will answer it. You need to provide at least (1) a description of your problem, (2) how you tried to solve it yourself already, and (3) where and how you are stuck.

1 answer

To help you on the way, you can figure the rest out yourself:

#include <stdio.h>
#include <string.h>
int main()
{
    char sequence[] = "TAGAGCGTAGCGACGTACTGATC";
    printf("Amount of codons: %d\n", (int)strlen(sequence)/3);
}

Log in to answer this question.