cited in https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0208511
First complete chloroplast genomics and comparative phylogenetic analysis of Commiphora gileadensis and C. foliacea: Myrrh producing trees
seq_a = 'GAGAGATTTTCCAATTCGACG-------CGGGGTCAGG--GAAATTT'
seq_b = 'GAGAGATTGGCCTTAACTACCCAACCCACGGCCTGACCGAGGTCTTC'
G,A,C,T = Bases
- = INDEL
PYTHON - I am very new to programming and need some help, I would like to write a python program that will first find indels '-' in seq_a and then compare both sequences (seq_a and seq_b) downstream and upstream from the the indels counting the number of differences between the bases.
e.g.
seq_a - GG--GAAA
seq_b - CCGAGGTC
This example has 5 SNPS upstream and downstream from the the indel c-g, c-g, a-g, a-t, a-c
I was wondering if anyone could give me any pointers or ideas how I would start of this program?
Thanks :)
Assuming that you have your alignment in a file named "fasta.fas" this should get you started
from Bio import AlignIO
y=0
alignment = AlignIO.read("fasta.fas", "fasta")
for r in range(0,len(alignment[1].seq)):
if alignment[0,r] != alignment[1,r]:
if alignment[0,r] != "-" and alignment[1,r] != "-":
y=y+1
print r, alignment[0,r], alignment[1,r], y
else:
y=0
This returns position of SNP, nt in seq_A, nt in seq_B, running tally of the number of SNPs upstream of each indel
cited in https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0208511
First complete chloroplast genomics and comparative phylogenetic analysis of Commiphora gileadensis and C. foliacea: Myrrh producing trees
cited in
Complete chloroplast genomes of medicinally important Teucrium species and comparative analyses with related species from Lamiaceae https://media.proquest.com/media/hms/PFT/1/PIi9A?_s=oXllOyF0mU%2BY2Zya4BZ5dUOHgNI%3D
cited in : https://peerj.com/articles/9132/
Comparative analysis of four Zantedeschia chloroplast genomes: expansion and contraction of the IR region, phylogenetic analyses and SSR genetic diversity assessment
Log in to answer this question.
Note that the easiest solution is to use biopython. It has some built-in facilities to perform alignment (e.g. the pairwise2 module) and can also just use command line alignment tools that tend to be faster.