This is a test version of Biostars. For the public version, visit https://www.biostars.org.
restriction digest to test for CRISPR disruption

I have a question about restriction enzymes and their use in helping to ID CRISPR induced mutations. Once a CRISPR causes an indel at a target sequence, a restriction enzyme can be used to screen several individuals exposed to the CRISPR, screening them for signs of an indel. I am not clear on a point related to this. Do I need to choose a restriction enzyme that binds to the area where the CRISPR induces a mutation? Or do I need to choose a restriction enzyme that cuts in the area where the CRISPR induces a mutation?

sequence restriction-enzyme crispr genotyping
• 2,270 views • link
updated by Ram Ram • written by es • es

Hello es!

We believe that this post does not fit the main topic of this site.

This is a molecular biology question; even though very limited bioinformatics skills might be needed to design and analyze a Crispr experiment, this question doesn't contain anything relevant to bioinformatics.

Btw, why don't you just sequence the region by designing PCR primers and then sanger?

For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.

If you disagree please tell us why in a reply below, we'll be happy to talk about it.

Cheers!

• 0 views • link
updated by Ram Ram • written by Michael Dondrup Michael Dondrup

0 answers

No answers yet.

Log in to answer this question.

More posts like this
  • News: Building an mmCIF parser for enzyme structure analysis — feedback & ideas welcome!
    written by Shravya • Shravya
    Hi everyone, I'm a bioinformatics student currently working on a project to build a Python-based parser for **mmCIF files**, focused on analyzing **enzyme structures** like …
  • News: Course - Introduction to CRISPR
    written by Physalia-courses Physalia-courses
    Dear all, we have the last 4 seats available for the course "Introduction to CRISPR for ecology and evolution studies": https://www.physalia-courses.org/courses-workshops/course53/ > Dates: online, October …
  • Unexpected bimodal distribution of LFC when analyzing pooled CRISPR screen using DESeq2
    written by Kristof • Kristof
    Hi, I'm using DESeq2 to analyze a pooled CRISPR screen where thousands of precise mutations are induced in different yeast cells (SNPs, indels), reflecting natural …
  • Identifying off-target mutation frequency in Bacterial genomes
    written by pd378 • pd378
    Hello and thank you in advance for any assistance with my problem. I am working with a dCas9-deaminase base editor and I am trying to …
  • Enzyme substrate prediction - where to start?
    written by SushiRoll • SushiRoll
    Hi everyone! I'm currently working on a project in which a drug is being broken down by a certain species of bacteria. I would like …
  • Double Digest through Regular Expression in python
    written by anasjamshed anasjamshed
    I have the following DNA sequence in dna.txt file : ``` ATGGCAATAACCCCCCGTTTCTACTTCTAGAGGAGAAAAGTATTGACATGAGCGCTCCCGGCACAAGGGCCAAAGAAGTCTCCAATTTCTTATTTCCGAATGACATGCGTCTCCTTGCGGGTAAATCACCGACCGCAATTCATAGAAGCCTGGGGGAACAGATAGGTCTAATTAGCTTAAGAGAGTAAATCCTGGGATCATTCAGTAGTAACCATAAACTTACGCTGGGGCTTCTTCGGCGGATTTTTACAGTTACCAACCAGGAGATTTGAAGTAAATCAGTTGAGGATTTAGCCGCGCTATCCGGTAATCTCCAAATTAAAACATACCGTTCCATGAAGGCTAGAATTACTTACCGGCCTTTTCCATGCCTGCGCTATACCCCCCCACTCTCCCGCTTATCCGTCCGAGCGGAGGCAGTGCGATCCTCCGTTAAGATATTCTTACGTGTGACGTAGCTATGTATTTTGCAGAGCTGGCGAACGCGTTGAACACTTCACAGATGGTAGGGATTCGGGTAAAGGGCGTATAATTGGGGACTAACATAGGCGTAGACTACGATGGCGCCAACTCAATCGCAGCTCGAGCGCCCTGAATAACGTACTCATCTCAACTCATTCTCGGCAATCTACCGAGCGACTCGATTATCAACGGCTGTCTAGCAGTTCTAATCTTTTGCCAGCATCGTAATAGCCTCCAAGAGATTGATGATAGCTATCGGCACAGAACTGAGACGGCGCCGATGGATAGCGGACTTTCGGTCAACCACAATTCCCCACGGGACAGGTCCTGCGGTGCGCATCACTCTGAATGTACAAGCAACCCAAGTGGGCCGAGCCTGGACTCAGCTGGTTCCTGCGTGAGCTCGAGACTCGGGATGACAGCTCTTTAAACATAGAGCGGGGGCGTCGAACGGTCGAGAAAGTCATAGTACCTCGGGTACCAACTTACTCAGGTTATTGCTTGAAGCTGTACTATTTTAGGGGGGGAGCGCTGAAGGTCTCTTCTTCTCATGACTGAACTCGCGAGGGTCGTGAAGTCGGTTCCTTCAATGGTTAAAAAACAAAGGCTTACTGTGCGCAGAGGAACGCCCATCTAGCGGCTGGCGTCTTGAATGCTCGGTCCCCTTTGTCATTCCGGATTAATCCATTTCCCTCATTCACGAGCTTGCGAAGTCTACATTGGTATATGAATGCGACCTAGAAGAGGGCGCTTAAAATTGGCAGTGGTTGATGCTCTAAACTCCATTTGGTTTACTCGTGCATCACCGCGATAGGCTGACAAAGGTTTAACATTGAATAGCAAGGCACTTCCGGTCTCAATGAACGGCCGGGAAAGGTACGCGCGCGGTATGGGAGGATCAAGGGGCCAATAGAGAGGCTCCTCTCTCACTCGCTAGGAGGCAAATGTAAAACAATGGTTACTGCATCGATACATAAAACATGTCCATCGGTTGCCCAAAGTGTTAAGTGTCTATCACCCCTAGGGCCGTTTCCCGCATATAAACGCCAGGTTGTATCCGCATTTGATGCTACCGTGGATGAGTCTGCGTCGAGCGCGCCGCACGAATGTTGCAATGTATTGCATGAGTAGGGTTGACTAAGAGCCGTTAGATGCGTCGCTGTACTAATAGTTGTCGACAGACCGTCGAGATTAGAAAATGGTACCAGCATTTTCGGAGGTTCTCTAACTAGTATGGATTGCGGTGTCTTCACTGTGCTGCGGCTACCCATCGCCTGAAATCCAGCTGGTGTCAAGCCATCCCCTCTCCGGGACGCCGCATGTAGTGAAACATATACGTTGCACGGGTTCACCGCGGTCCGTTCTGAGTCGACCAAGGACACAATCGAGCTCCGATCCGTACCCTCGACAAACTTGTACCCGACCCCCGGAGCTTGCCAGCTCCTCGGGTATCATGGAGCCTGTGGTTCATCGCGTCCGATATCAAACTTCGTCATGATAAAGTCCCCCCCTCGGGAGTACCAGAGAAGATGACTACTGAGTTGTGCGAT ``` I want to read the DNA sequence from the file dna.txt and …
  • With Python, how can I solve this restriction mapping problem?
    written by francois • francois
    I'm struggling with the following Python project, which I'll call **multi-digest restriction mapping**. It is originally a bioinformatic problem, but you really do not need …
  • Software to analyse mutations in sanger sequencing files
    written by reilly.brian.m reilly.brian.m
    I am interested in finding a free software package to analyse sanger sequencing files (ab1). The software needs to be able to align the sequences …
  • Genomic Restriction Finder
    written by rhasbunz • rhasbunz
    <p>Dear all</p> <p>I need to create a bed file with all restriction sites of a genome in FASTA. The bed table need to have in …
  • Get The Fasta Sequence Using Genomic Position
    written by farah • farah
    <p>Hello, I have a VCF file of 816 individuals. I found a mutation carried by 1 individual. I have the chromosome position where I found …