This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Using BLAST to determine assay specificity : how many N's

We are creating assays using primer 3.

Primer left: AGCTGTACCATACCTGTCTGG
Start / stop position: chr1 115252177 - 115252198
Primer right: AGGGAGCAGATTAAGCGAGT
Start / stop position: chr1 115252351 - 115252371

There is quite a distance between our two primers: 115252351 - 115252198 = 153 bases.

We are currently running specificity checks against each individual primer, using BLAST. I have been told that it is possible to check the specificity of the assay as a whole, by submitting the two primers separated by N's.

ie:

AGCTGTACCATACCTGTCTGGNNNNNNNNNNNNNNNNNNAGGGAGCAGATTAAGCGAGT

Questions

  1. Is this a correct way to blast both sides of the assay?
  2. Must the number of N's match the distance between the primers (153 in the case) or is an arbitrary number sufficient?
blast

1 answer

  1. This is workable way to blast short sequences (e.g. primers) against database.
  2. According to the program selection guide from NCBI (section 4.3): "A useful way to check a pair of PCR primers is to first concatenate them by inserting string of 20 or more N's in between the two primers, and then search the concatenated pair as one sequence. Since BLAST looks for local alignments and automatically searches both strands, there is no need to reverse complement the reverse primer before doing the concatenation or the search. "

Log in to answer this question.