Hello,

I have some microRNAseq data and I want to compare those with the miRbase. I am using miRExpress. Since for the animal I used here they don't have a specific miRNA database, I just downloaded all the data from all species and merge them togehter. I call it all_precursor.txt.

This database mach failed (in miRExpress it's called alignmentSIMD), following is the error information.

I guess the problem is it contains some ambiguous nucleotide like B here. Dear fellows, how can I fix this problem? I am new to this RNAseq area. Thank you very much!

Illegal character! UGGUAUGGGCAUUGUUGCCAAUACAGGAGAACGUGGBUCUUUUUGACAUAAUGCCUAGAACUACCCAUAGCUCCAUCCCAACUCAUAAAUAGGAGGAUAAGACUGAAUUCACGUCCUCCUAUACUGGUAACAAUGCGCAUGCCAA