This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Counting Repeat Sequence

Hello-

I want to count repeats in DNA sequnences using Phython

ex ) "AGTCATCATGTGTAAGCGTAGCATCATCATCATCATCATCATCATCATCATCCGTGAGTCAGAGAT"

  1. How many time repeat 'CAT'

  2. if 'CAT' < 4(times of repeat) = 'boy' , CAT >= 5 = 'girl' (just example!! :-)

Finally, i hope see that

" your 'CAT' repeat is 6, 

      so, you are a girl!!!

please tell adn help me how to make this souse...

repeats sequence python
• 11,561 views • link
updated by Eric Fournier Eric Fournier • written by Takeo • Takeo

Phython? No such language, so far as I know :)

• 0 views • link
written by Neilfws Neilfws

5 answers

perhaps a fastest way:

s="AGTCATCATGTGTAAGCGTAG*CATCATCATCATCATCATCATCATCATCAT*CCGTGAGTCAGAGA"
print 'girl' if s.count('CAT') > 4 else 'boy'

EDIT: in order to fin specifically repeats:

import re
print 'girl' if len (re.findall('((?<=CAT)CAT)', s)) > 4 else 'boy'
• 0 views • link
written by fransua fransua

This counts all occurrences not just repeat occurrences.

• 0 views • link
written by Farhat Farhat

@Farhat @Aleksandr Levchuk this is true, and than your solution is good... I also edited my post in order to give an other solution. thanks

• 0 views • link
written by fransua fransua

Great! That's a better way.

• 0 views • link
written by Farhat Farhat

@fransua Thank you so much!!! and i have a one question!! if i will add some options, how i can do? ex) if CAT repeat < 4 times ---- boy if CAT repeat > 4 times ---- gilr if CAT repeat > 5 times ---- blue eye gilr if CAT repeat > 6 times ---- black eye gilr if CAT repeat > 7 times ---- brown eye gilr (ALSO, JUST EXAMPLE!!!!)

• 0 views • link
written by Takeo • Takeo

Regular expressions would be ideal for dealing with this.

import re

patt='(CAT)+'

string='asdsaCATCATCATsdaCATasa'

p=re.compile(patt)
replen=[sp.end()-sp.start() for sp in p.finditer(string)]

print max(replen)/(len(patt)-3)
• 1 views • link
written by Farhat Farhat

I think the question is, "was CAT repeated 4 times in a row?". That would be useful for counting tandem repeats. Using that definition, Aleksandr's code which reports 4 for "CATGGGGGCATCATCAT" wouldn't give the correct answer. Here's quick and dirty code to get the maximum number of consecutive repeats for a string:

s="AGTCATCATGTGTAAGCGTAG*CATCATCATCATCATCATCATCATCATCAT*CCGTGAGTCAGAGA"
search = "CAT"
N = len(s)
n = len(search)
x = 0
reps = 0
last=(-1*n)-1
maxreps=0
while x > -1:
    x = s.find( search, x)
    print x
    if x>-1:
        if x==last+n:
            reps += 1
            if reps>maxreps:
                maxreps=reps
        else:
            reps=1
            maxreps=1
        last = x
        x=x+n

print maxreps # returns 10
print maxreps>4 # returns True
• 2 views • link
written by David Quigley David Quigley

Here is one way to do it:

def count_repeats(seq):
  subject = "CAT"
  return len(seq.split(subject)) - 1

# Testing
assert count_repeats("CATGGGGGCATCATCAT") == 4
assert count_repeats("ACATGGGGGCATCATCATGGGGGG") == 4
assert count_repeats("ACATGGGGGCATCATCAT") == 4
assert count_repeats("CATGGGGGCATCATCATGGGGGG") == 4

if count_repeats("CATGGGGGCATCATCAT") < 4:
   print "Boy"
else:
   print "Girl"
• 0 views • link
written by Aleksandr Levchuk Aleksandr Levchuk

Is there any particular reason why you want to use Python for this? If you're dealing with Repeats, RepeatMasker is the way to go. It will detect short tandem repeats like the one you have, and tell you just how many instances of the repeated element are found.

• 2 views • link
written by Eric Fournier Eric Fournier

Log in to answer this question.

More posts like this