What Does The Genome-Read-Mismatches Option Do Intophat

Hii Everyone

I am using tophat2 software for mapping reads. In the Advanced Options section for tophat2 i come across 2 options namely

 --genome-read-mismatches       <int>       [ default: 2 ]
 -N/--read-mismatches           <int>       [ default: 2  ]

Can someone explain me what is the difference between these options.

Hope to hear from you guys..

Regards

tophat

• 2,333 views • link

updated 13.8 years ago by Istvan Albert

• written 13.8 years ago by Varun Gupta

1 answer

This has been answered in Understanding --genome-read-mismatches and --read-mismatches parameter in tophat

• 0 views • link

written 13.8 years ago by Istvan Albert

More posts like this

extracting the soft clipped seq only from a sam file
written 11.6 years ago by Varun Gupta

HI Everyone, I have a sam file something like this <pre> SRR959756.117 272 RNU6-170P 141 9 23S21M * 0 0 TAGAGACGGGGTCTCGCTATGTTGCTCAGGCTGGAGTGCAGTGG SRR959756.117 272 RNU6-171P 139 …
bwa mem mismatch option
written 11.9 years ago by Varun Gupta

Hi Everyone, I am using bwa mem to align my paired end read data. My reads are 150bp in length(paired end). I am using bwa …
Bwa Mem -M Option
written 12.3 years ago by Varun Gupta

Hello I want to align my reads to the reference genome and then use GATK for downstream analysis. I am using <a href='http://bio-bwa.sourceforge.net/'>bwa</a> mem protocol. …
Tophat Alignment Score And Parameters
written 13.4 years ago by Varun Gupta

Hello Everyone I am using tophat2 for my rna seq data set. I mostly always use default options for tophat. I have some doubts when …
How To Make Use Of The Cufflinks Output In Further Analysis
written 13.4 years ago by Varun Gupta

Hello I am working on RNA-seq data and i used hg19 genome as reference. I used TOPHAT and generated accepted.hits.bam file. I ran cufflinks onto …
Why Is Tophat Reporting Secondary Alignments Even When The Option To Do So Is Turned Off
written 13.5 years ago by Varun Gupta

Hi Everyone I am working with Rna seq data and for that i am using TOPHAT aligner. I came across 2 options in tophat which …
Differences In The Read Mapping Percentages When Using Bowtie And Gsnap
written 13.6 years ago by Varun Gupta

Hi I am using CHIP-seq data from ENCODE. I made my own ref genome of some of the genes i am interested. I created …
Hmmsplicer Junctions
written 14.1 years ago by Varun Gupta

Hi Everyone I am dealing with RNA seq data and i am using different softwares for detection of splicing events. I came across hmmsplicer tool. …
Tophat Junctions Bed File Strand Column
written 14.1 years ago by Varun Gupta

Hi Everyone So when we use tophat(rna seq data) we get a junctions.bed file produced as a result. Can someone explain me what does column6 …
Read Counts For Genes
written 14.4 years ago by Varun Gupta

Hi everyone I am working on RNA SEQ data for pombe genome. I mapped the reads with the pombe genome and created sam/bam files. Now …