Hi,

I have a list of mutations and their genomic positions.

for example:

chr1:1573209-1573209 T>A

and I have fasta sequences of the consensus sequence around the sites of these mutations.

for example:

>hg19_ct_UserTrack_3545_CDK11A range=chr1:1573157-1573247 5'pad=10 3'pad=10 strand=+ repeatMasking=lower
GAGGATGGTGTTGATCTCCCTCAGCGACGTGATCGGGAAGCCCTCCTTCT
CCTTCTCCATCTTCAGCCGCTTTAGAGCCACAATTTCATCT

Is there any tool that can insert the mutation into the fasta?

and more complicated - a tool that can combine several different mutations in the same fasta?

I wrote a perl script that creates a fasta for each mutation, but now I need to create all possible combinations of mutations (i.e. if there are 3 different mutations in a single fasta sequence, I need all the combinations: mut1 + mut2, mut2 + mut3, mut1 + mut2 + mut3), and I wonder if there is an existing tool that can do that.

Thanks in advance for any help