I always have trouble to use "samtools view" command to deal with "bwa mem" aligning result, but if I use "bwa sampe" then everything goes fine.
The head lines of aligning results is as follows:
[M::main_mem] read 100000 sequences (10000000 bp)...
[M::mem_pestat] # candidate unique pairs for (FF, FR, RF, RR): (0, 45245, 0, 0)
[M::mem_pestat] skip orientation FF as there are not enough pairs
[M::mem_pestat] analyzing insert size distribution for orientation FR...
[M::mem_pestat] (25, 50, 75) percentile: (686, 699, 713)
[M::mem_pestat] low and high boundaries for computing mean and std.dev: (632, 767)
[M::mem_pestat] mean and std.dev: (699.49, 20.02)
[M::mem_pestat] low and high boundaries for proper pairs: (605, 794)
[M::mem_pestat] skip orientation RF as there are not enough pairs
[M::mem_pestat] skip orientation RR as there are not enough pairs
[M::mem_process_seqs] Processed 100000 reads in 17.108 CPU sec, 17.240 real sec
@SQ SN:chr17 LN:81195210
@PG ID:bwa PN:bwa VN:0.7.8-r455 CL:bwa mem /gpfs/home/cxs1031/backup/ref/chr17.fa simulated_huref_chr17_10x_1.fq simulated_huref_chr17_10x_2.fq
chr17_43074173_43074853_0:0:0_0:0:0_0 99 chr17 43122985 60 100M = 43123566 681 AGCTACTTGGGAAGCTGAAGAAGGAGAATCACTTGAACCCGGGAGGGGGAGGTTGCAGTG
AGCAGAGATCGCACCACTGCGCTCCAGCCTGAGCAACAGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 MD:Z:100 AS:i
:100 XS:i:0
chr17_43074173_43074853_0:0:0_0:0:0_0 147 chr17 43123566 60 100M = 43122985 -681 GACAATATATTGGGCTAAAAGATGAGGAAAATGTGGGAGAGAGTGCCTAGGAAGGTGAGC
TTCCCAGCAGGCGGAACTAGAGTGTAAGAGCAGCACTTTC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 MD:Z:100 AS:i
:100 XS:i:0
And I use "samtools view" command as follows:
samtools view -t chr17.fa.fai -S -b chr17_10x.sam > chr17_10x.bam
Then I get error as follows:
[sam_header_read2] 1 sequences loaded.
[sam_read1] reference '[M::mem_pestat] skip orientation FF as there are not enough pairs' is recognized as '*'.
Parse error at line 1: invalid CIGAR character
Aborted (core dumped)
Did some one meet this problem before?
•
written
by
Chen Sun
1 answer
When you use bwa mem, don't redirect standard error to your SAM file. The first 10 or so lines of the SAM file simply don't belong there and wouldn't have been there had you not incorrectly redirected the output.
•
written
by
Devon Ryan
Most likely you are either redirecting using something like &> or you are using the nohup utility which combines stderr and stdout in one stream and messes with tools like this. You can also disable all stderr messages by passing the argument -v 0 to bwa mem.
•
written
by
Matt Shirley
Log in to answer this question.
-
Error of SAM file
written by Pish •
-
BWA mem skip orientation
written by williamsbrian5064
-
there are not enough pairs message on screen when running BWA MEM
written by S AR
-
sam file error
written by 2yuna710 •
-
Error when sorting a SAM file with samtools sort, sam file created with bwa mem
written by mpyle •
-
BWA mapping ERROR
written by meekadi •
-
bwa -mem log messages
written by aleka
-
Skip orientation RF
written by Folder40g
-
BWA MEM 0.7.12 Error : [gzread] <fd:4>: invalid distance code
written by gsr9999
-
Error while running BWA mem
written by ravi.uhdnis
