i am merging overlapping paired end sequences
• 0 views
•
link
assume these are fastq-illumina quality scores and the sequence is unambiguous dna
I want to create a SeqRecord object from this. Thanks.
This answer is a bit of a cheat, but currently Biopython doesn't expose the FASTQ quality string decoding functionality in the public API:
from Bio import SeqIO
from StringIO import StringIO
fastq_string = "@%s\n%s\n+\n%s\n" % (id1, seq1, qual1)
record = SeqIO.read(StringIO(fastq_string), "fastq-illumina")
Why are you trying to do this?
i am merging overlapping paired end sequences
>>> id1 ="HWI-EAS380:8:1:16:830/1"
>>> seq1 ="AGGGCGTTCAGCAGCCAGCTTGCGGCAAAACTGCGTAACCGTCTTCTCGTT"
>>> from Bio.SeqRecord import SeqRecord
>>> from Bio.Seq import Seq
>>> sr = SeqRecord(Seq(seq1), id1, '', '')
>>> sr
SeqRecord(seq=Seq('AGGGCGTTCAGCAGCCAGCTTGCGGCAAAACTGCGTAACCGTCTTCTCGTT', Alphabet()), id='HWI-EAS380:8:1:16:830/1', name='', description='', dbxrefs=[])
i need the quality in the record the whole per-letter-annotation thing is what is giving me trouble
Log in to answer this question.