How to process Iso-Seq files in SRA public fastqs
I am currently practicing Iso-seq data. I downloaded SRR30229262 from NCBI and try to process as paper link claimed. Program: lima v2.13.0 / pbmm2 v1.17.0 I used the genome in our lab here, but I think it can be reference here.
pbmm2 align --unmapped --sort -j 128 00_start_annotation/JPeel5_2.fasta SRR30229262.fastq SRR30229262.bam
nohup lima --isoseq -j 128 05_raw_RNA_PacBio/SRR30229262.bam 05_raw_RNA_PacBio/primers.fasta05_flnc_RNA_PacBio/SRR30229262_flnc.bam > 05_flnc_RNA_PacBio/SRR30229262_flnc.log 2>&1 &
But lima seems to not take any computation resources to process, and only show that it is running when I use "jobs". I am not sure how to solve this tough question. The primer I used:
>primer_5p
AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
>primer_3p
AAGCAGTGGTATCAACGCAGAGTAC
• 811 views
•
link
0 answers
No answers yet.
Log in to answer this question.
What does this mean? Are there any messages in the
05_flnc_RNA_PacBio/SRR30229262_flnc.log? Sometimes programs can take a significant amount of time to process things in memory before any output is written.Looks like
limacan accept fastq reads (https://lima.how/get-started.html ) so perhaps you should process the data from NCBI (which is in fastq format) first before you align withpbmm2.No, the files that it generated were all empty. I did use "top" to check if there is any program use large amount of resources, but I did not see any running program did that. I did run with the bam file that pbmm2 generate, too. The result was same, my terminal stuck on it, and I did not see any related program running. I used cutadapt in the end.