This is a test version of Biostars. For the public version, visit https://www.biostars.org.
ZMW s above all thresholds was 0% after lima primer removal

I used lima to remove primer from my Isoseq data , and got the summary:

ZMWs input                (A) : 768300
ZMWs above all thresholds (B) : 18 (0%)
ZMWs below any threshold  (C) : 768282 (100%)

ZMW marginals for (C):
Below min length              : 14 (0%)
Below min score               : 0 (0%)
Below min end score           : 251313 (33%)
Below min passes              : 31 (0%)
Below min score lead          : 0 (0%)
Below min ref span            : 700907 (91%)
Without SMRTbell adapter      : 31 (0%)
Undesired 5p--5p pairs        : 25887 (3%)
Undesired 3p--3p pairs        : 685276 (89%)
Undesired no hit              : 31 (0%)

ZMWs for (B):
With different pair           : 18 (100%)
Coefficient of correlation    : 0%

ZMWs for (A):
Allow diff pair               : 768269 (100%)
Allow same pair               : 768269 (100%)

Reads for (B):
Above length                  : 18 (100%)
Below length                  : 0 (0%)

my command:

 lima --isoseq -j 20 3d-F1-ccs.bam primers.fasta 3d-F1-lima.bam
primers.fasta
>primer_5p
AAGCAGTGGTATCAACGCAGAGTACATGGGG
>primer_3p
AAGCAGTGGTATCAACGCAGAGTAC

what happened? Thank you!

lima summary isoseq
• 1,791 views • link
updated by GenoMax GenoMax • written by wzw0029 • wzw0029

I have the same problem, has it been solved?

• 0 views • link
written by JZX • JZX

1 answer

Okay, I seem to understand something. I converted my ccs.bam to ccs.fastq, founding the primers were different from the values I put in Lima. When I changed the primers.fasta file and rerun Lima, everything became normal.

Make sure enter the correct FASTA file.

• 0 views • link
written by JZX • JZX

Log in to answer this question.

More posts like this