ZMW s above all thresholds was 0% after lima primer removal
I used lima to remove primer from my Isoseq data , and got the summary:
ZMWs input (A) : 768300
ZMWs above all thresholds (B) : 18 (0%)
ZMWs below any threshold (C) : 768282 (100%)
ZMW marginals for (C):
Below min length : 14 (0%)
Below min score : 0 (0%)
Below min end score : 251313 (33%)
Below min passes : 31 (0%)
Below min score lead : 0 (0%)
Below min ref span : 700907 (91%)
Without SMRTbell adapter : 31 (0%)
Undesired 5p--5p pairs : 25887 (3%)
Undesired 3p--3p pairs : 685276 (89%)
Undesired no hit : 31 (0%)
ZMWs for (B):
With different pair : 18 (100%)
Coefficient of correlation : 0%
ZMWs for (A):
Allow diff pair : 768269 (100%)
Allow same pair : 768269 (100%)
Reads for (B):
Above length : 18 (100%)
Below length : 0 (0%)
my command:
lima --isoseq -j 20 3d-F1-ccs.bam primers.fasta 3d-F1-lima.bam
primers.fasta
>primer_5p
AAGCAGTGGTATCAACGCAGAGTACATGGGG
>primer_3p
AAGCAGTGGTATCAACGCAGAGTAC
what happened? Thank you!
• 1,804 views
•
link
1 answer
Okay, I seem to understand something. I converted my ccs.bam to ccs.fastq, founding the primers were different from the values I put in Lima. When I changed the primers.fasta file and rerun Lima, everything became normal.
Make sure enter the correct FASTA file.
• 0 views
•
link
Log in to answer this question.
I have the same problem, has it been solved?