I am attempting to extract the PI2R gene from chromosome 19 of Homo sapiens using the Phase 3 VCF file of the 1000 Genomes Project. My goal is to:

1. Identify variants for each sample,
2. Retrieve the corresponding nucleotide sequence,
3. Translate it into protein,
4. Detect missense variations and CNVs.

I followed these steps using this post BCFtools consensus as a reference:

1. Extracted the PI2R region:

   bcftools view -Oz -r 19:46618550-46625089 ALL.chr19.phase3_shapeit2_mvncall_integrated_v5b.20130502.genotypes.vcf.gz > pi2r.1000g.vcf.gz
   tabix -p vcf pi2r.1000g.vcf.gz
   

2. Prepared the reference genome:

   samtools faidx GRCh38_full_analysis_set_plus_decoy_hla.fa
   sed -e 's/^>chr/>/' GRCh38_full_analysis_set_plus_decoy_hla.fa > out.fa
   samtools faidx out.fa
   

3. Iterated through samples and generated sequences:

   for sample in `bcftools view -h pi2r.1000g.vcf.gz | grep "^#CHROM" | cut -f10-`; do
   bcftools view -c1 -Oz -s $sample -o 1000g.$sample.vcf.gz pi2r.1000g.vcf.gz
   tabix -p vcf 1000g.$sample.vcf.gz
   samtools faidx out.fa 19:46618550-46625089 | bcftools consensus 1000g.$sample.vcf.gz -o 1000g.pi2r.$sample.fasta
   done
   

However, I encountered the following error:

The fasta sequence does not match the REF allele at 19:46618630:
   REF .vcf: [A]
   ALT .vcf: [G]
   REF .fa : [T]CGCAGTAAGATACACATAACATAAAAGTTGCTATTTTAA
The fasta sequence does not match the REF allele at 19:46618630:
   REF .vcf: [A]
   ALT .vcf: [G]
   REF .fa : [T]CGCAGTAAGATACACATAACATAAAAGTTGCTATTTTAA
The fasta sequence does not match the REF allele at 19:46618630:
   REF .vcf: [A]
   ALT .vcf: [G]
   REF .fa : [T]CGCAGTAAGATACACATAACATAAAAGTTGCTATTTTAA
The fasta sequence does not match the REF allele at 19:46618630:
   REF .vcf: [A]
   ALT .vcf: [G]
   REF .fa : [T]CGCAGTAAGATACACATAACATAAAAGTTGCTATTTTAA
The fasta sequence does not match the REF allele at 19:46618630:
   REF .vcf: [A]
   ALT .vcf: [G]
   REF .fa : [T]CGCAGTAAGATACACATAACATAAAAGTTGCTATTTTAA
The fasta sequence does not match the REF allele at 19:46618630:
   REF .vcf: [A]
   ALT .vcf: [G]
   REF .fa : [T]CGCAGTAAGATACACATAACATAAAAGTTGCTATTTTAA

Question:

1. Am I using the correct reference genome for the Phase 3 VCF alignment? If not, which reference sequence should I use?
2. Could there be other reasons for this mismatch? How can I resolve it to ensure the consensus sequences match the VCF data?