Alternative nucleotide fasta file
Hi everybody,
I am seeking for a method to make a alternative nucleotide file required for epiG package. The original references are: https://genomebiology.biomedcentral.com/articles/10.1186/s13059-017-1168-4
The package demands a SNP fasta (called alternative nucleotide fasta, alt-fa) match with reference fasta. For example Reference fasta:
>chr20
agctgctcgcgcgtagcagcgagcagcagctattcaagcag
alt-fa should replace the possible nucleotide in reference with the other allele and rest nucleotide with symbol "-" :
>chr20-alt
----c----a----t-----c-----t----t-----c---
Does anybody know a tool can do this? Maybe a vcf file and a reference fasta are required for that.
• 1,646 views
•
link
written
by
Yijun Tian •
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Can a dot (.) be used as the ALT field for a deletion in a VCF file?
written by terdon
-
Biological meaning of metrics commonly used for QC in scRNA-seq?
written by txema.heredia •
-
How to Resolve Reference Mismatch While Extracting Gene Variants from 1000 Genomes Project Phase 3 …
written by Rohan •
-
ORFik: error making Txdb from GTF and fasta files
written by Estefania •
-
gatk, ref and alt percentages .
written by Sabeen •
-
Freebayes - not detecting some ALT alleles
written by z.klinovska •
-
Job: Bioinformatician position available at Sloan-Kettering NYC: post-transcriptional genomics
written by laie •
-
Replace _ in sequences with variant allele in fasta header
written by Yijun Tian •
-
Adding text to ideogram in ggbio (or other method recommendations)?
written by Alexander Skates
-
Programming Challenge - Synthetic Whole Genome Vcf
written by Mahdi Sarmady
I found a recent article it may be useful:
https://academic.oup.com/bioinformatics/advance-article-abstract/doi/10.1093/bioinformatics/btx595/4160682