Alternative nucleotide fasta file

Question

[Yijun Tian]

Hi everybody,

I am seeking for a method to make a alternative nucleotide file required for epiG package. The original references are: https://genomebiology.biomedcentral.com/articles/10.1186/s13059-017-1168-4

The package demands a SNP fasta (called alternative nucleotide fasta, alt-fa) match with reference fasta. For example Reference fasta:

>chr20
agctgctcgcgcgtagcagcgagcagcagctattcaagcag

alt-fa should replace the possible nucleotide in reference with the other allele and rest nucleotide with symbol "-" :

>chr20-alt
----c----a----t-----c-----t----t-----c---

Does anybody know a tool can do this? Maybe a vcf file and a reference fasta are required for that.

[natasha.sernova]

I found a recent article it may be useful:

https://academic.oup.com/bioinformatics/advance-article-abstract/doi/10.1093/bioinformatics/btx595/4160682