This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How to make .fasta file

I have downloaded something that looks like a fasta file that from UTRdb 2.0 (http://utrdb.cloud.ba.infn.it/utrdb/). Upon closer look, it is not recognized as a fasta file. I am wondering how to convert the file into fasta. I have attached the file in the link below. Some help please.

https://www.dropbox.com/scl/fi/uuv2tssoxnaeih2vvzqjq/Glossina_fuscipes.Yale_Gfus_2.54.utrs.gz?rlkey=cv02l92iqtypj1t3iez7wlhez&dl=0

Thanks for the help.

fasta utrdb
• 2,160 views • link
updated by Ram Ram • written by otieno43 • otieno43

2 answers

Seems like the file is fasta but has some comments at start of the file like

#genome-build: ASM210954v1
#genome-version: ASM210954v1
#genome-date: 2017-04
#genome-build-accession: GCA_002109545.1
#genebuild-last-updated: 2020-03
>|five_prime_utr|ENSAPOT00000006813|ENSAPOG00000008320|61446_61655_+_MVNR01001590.1
GTTTCAGGACAACGATGCGGAGAATGGCGATAAAATAACACACAAAACTTTGGAAACCCC
CAAAGACATCTACCCCATTCATGTTGTTCCAGAAAATAAAGAGAGGACACAGGGATCATG
TGCCCACTTTAAGGAGAGGAAAGACGTCACAAAGCAGGTCCGCTCCAAGTCCCCCACACT
GTTGGTCAACTTGGAGGAGGCCTTGGAAAG

you can try removing them by

grep -v ^"#" input-file.utrs > output-file.utrs/fasta
• 0 views • link
written by SomeOne • SomeOne

output-file.utrs/fasta

Did you mean to say output-file.utrs.fasta?

• 0 views • link
written by GenoMax GenoMax

i meant about the extention. either .utrs or .fasta

• 0 views • link
written by SomeOne • SomeOne

I think the output can still be either file.utrs.fasta or just file.fasta.

• 0 views • link
written by otieno43 • otieno43

Let me try get rid of them and see what happens.

• 0 views • link
written by otieno43 • otieno43

This worked very well, thank you.

• 0 views • link
written by otieno43 • otieno43

Your file is a gzipped archive. You must first unpack it with gunzip:

gunzip Glossina_fuscipes.Yale_Gfus_2.54.utrs.gz

That will make a file Glossina_fuscipes.Yale_Gfus_2.54.utrs with your UTRs in FASTA format.

• 0 views • link
written by Mensur Dlakic Mensur Dlakic

Had done this before and have repeated again but it still does not come up as fasta file but just like any other normal file with fasta file features.

• 0 views • link
written by otieno43 • otieno43

Log in to answer this question.

More posts like this