This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Error Code 3 with fastq-dump

I am attempting to download the fast-files of a particular set of genomes, but I am met with the following error messages:

fastq-dump.3.0.9 err: name not found while resolving query within virtual file system module - failed to resolve accession 'XYZ' - no data ( 404 ); ncbi_phid=322CF33EF0EEE94500005B76532034FC.1.m_6
fastq-dump.3.0.9 err: name not found while resolving query within virtual file system module - failed to resolve accession 'XYZ' - no data ( 404 ); ncbi_phid=D0BD65271B65E5250000357CB0C25804.1.m_2
fastq-dump.3.0.9 err: item not found while constructing within virtual database module - the path 'XYZ' cannot be opened as database or table
fastq-dump quit with error code 3
fastq-dump

Please provide an example accession number. There is no need to obfuscate that information.

The accession is as follows: ERR1279276'

https://www.ncbi.nlm.nih.gov/sra/?term=ERR1279276 the samples are not generated or there are some issue with the final file upload

Library:
Name: Complete Genomics
Instrument: Complete Genomics
Strategy: WGS
Source: GENOMIC
Selection: RANDOM
Layout: PAIRED
Construction protocol: Complete Genomics
Run # of Spots  # of Bases  Size    Published
ERR1279276  unavailable 2018-01-09

1 answer

This is a case where the data is not going to be available from SRA.

Please take a look at the README file for this data: https://ftp.sra.ebi.ac.uk/vol1/run/ERR127/ERR1279276/GS000018380-DID/GS000014333-ASM/README.2.2.0.txt

Data files are available from ENA here: https://www.ebi.ac.uk/ena/browser/view/ERR1279276


Reads are not in standard fastq format so the files will need to be reformatted. Here is an excerpt from one of the files that starts with reads*:

#ASSEMBLY_ID    GS000014333-ASM
#BATCH_FILE_NUMBER      9
#BATCH_OFFSET   240000000
#FIELD_SIZE     0
#FORMAT_VERSION 2.2
#GENERATED_AT   2012-Sep-22 17:08:31.921223
#GENERATED_BY   exportTools
#LANE   L01
#LIBRARY        GS01071-CLS_C05
#SAMPLE GS01567-DNA_H03
#SLIDE  GS50535-FS3
#SOFTWARE_VERSION       2.2.0.26
#TYPE   READS

>flags  reads   scores
4       CACAGAGAGTACACAACTCATAGCTCTATGACATTTTTGCCTGTTAGAAGGGAGCCGTTCTATCACAGAT  8:::88678899:998;<<<:/8+:&,6499880/4566655554;<<<<==<<;9989853066::799
5       AATATATATTACATTCTTTGTAAGTGCTGAGTCTATAGTTCTGATTTGAGCATCCATCTCTATAAAAAAA  89:;;7778'::9998;98<78'-&-,797.(+$(44566535517<<<<<=<<;99:::4(%3(;:999
5       CACCACACCACACACCACCACACACACCACCACCAACACCACCACACCACACCACCACCTCACCACACAC  89:;97.778999998;<=<<<<;;(89999780.55666355542<<;<:=<<;99::+55651:9999
0       AAAATATGATAGAAATACTGCATGTCAGATGGGAACAGTTGTCCCATCCATGGTGGATTGGTGCCCCCAA  8::;867478999998;<<;<*<+;78.889980.45545454.4;';;9<<<<;9999:55564+:998

Im curious how this was uploaded, isn;t that gets validated ? if they are not standard fastq

This is an upload from 2016 (but the data may have been generated in 2012 based on file above) so perhaps things were not as stringent back then. Which is likely why SRA does not have a copy of the data.

Log in to answer this question.