This is a test version of Biostars. For the public version, visit https://www.biostars.org.
PROVEAN input for stop codon

I've setup a local version of PROVEAN (http://provean.jcvi.org/index.php) to run variant effect prediction and rank the severity of amino acid changing variants. I noticed that there is no examples of encoding stop codons for the input. PROVEAN uses one letter amino acid code for the input variant like "C671Y" and all such examples worked fine. But I did not find an example of encoding the stop codons. If there is a stop codon gain mutation, such as C671stop, I tried a few different encoding, C671stop, C671*, C671X, and none of them is valid according to PROVEAN. Or, a stop gain is server enough for any protein, PROVEAN would not process this type of mutation? Does anyone have any experience with this? Any suggestion would be really helpful!

variant provean
• 1,185 views • link
written by Vitis Vitis

1 answer

There might be a bit more information in PROVEAN's readme: https://www.jcvi.org/sites/default/files/assets/projects/provean/downloads/README. Specifically in section (IV) they mention that variants are in the HGVS notation. This page (https://hgvs-nomenclature.org/stable/background/simple/) might have some more information on the notation (though wasn't able to directly see the notation for stop-gain mutations)

• 0 views • link
written by DGTool • DGTool

Went through the HGVS standard page and tried the following: "Ter" and "*" for stop codon introduced by substitutions, and in both scenarios PROVEAN complained about "C671Ter: invalid format", "C671*: invalid format".

• 0 views • link
written by Vitis Vitis

Log in to answer this question.

More posts like this
  • Blog: Google launches Bard (and it fails the translation test :)
    written by Michael Dondrup Michael Dondrup
    Google has launched Bard in the EU. Just for fun, I tested its basic molecular biology skills in the same way as with ChatGPT previously. …
  • How to parse the output file of snpEFF
    written by yoser4 • yoser4
    Hello everyone. I have a **vcf file** annotated with **snpEFF** (the input file for snpEFF was extracted from a snp vcf file of 99 samples, …
  • Looking for an Amino Acid Level Variant Caller
    written by cjg9101112 • cjg9101112
    Hello, I'm currently looking for an amino acid level variant caller for my data. I'm dealing with data that comes from saturation mutagenesis and, for …
  • Replace Ambigious codons with Amino acid sequences
    written by waqaskhokhar999 waqaskhokhar999
    I have two multi-fasta files, one contains nucleotide sequences, and a subset of nucleotide sequence for ORF1 is: >ORF1_BnaA03g18710D_S45:82:1509 ATGGCCGCCGCAGTTTCCACCGTCGGTGCCATCAACAGAGCTCCGTTGAGCTTGAACGGG TCAGGAGCAGGAGCTGCTTCAGTCCCAGCTACGACCTTCTTGGGAAAGAAAGTTGTAACC GCGTCGAGATTCACACAGAGCAACAACAAGAAGAGCAACGGATCATTCAAAGTGGTCGCT GTCAAAGAAGACAAACAAACCGATGGAGACAGATGGAGGGGACTTGCCTACGACACGTCT GATGATCAACAAGACATCACCAGAGGCAAAGGTATGGTTGACTCTGTCTTCCAAGCTCCC ATGGGAACCGGAACTCACAATGCCGTTCTTAGCTCCTATGAGTACATTAGCCAAGGTCTT …
  • VEP output and stop gain mutation
    written by seta seta
    Hi all, I annotated some variations (SNP) using VEP, there are two stop gain mutations, one at 2nd amino acid and another at the 110th …
  • PROVEAN input script
    written by s_herrera • s_herrera
    Hi everyone, I would like to write a python script to extract amino acid substitutions and indels from several protein alignments, and use it as …
  • GTF to FASTA including stop codon
    written by athey.johnc • athey.johnc
    I am looking for a way to extract coding sequences, including their stop codons where available, using a genome and GTF annotations. None of the …
  • Perl help regarding hash
    written by ksi216 • ksi216
    Hello, I've created a hash, of codons and amino acids. My program should allow a user to input a DNA codon and then output the …
  • Functional Relevance Of Stop Retained Variants?
    written by Rubal7 Rubal7
    <p>Hello Everyone,</p> <p>I am looking for functional variants in population genomic data. I have identified a candidate variant (high frequency and highly conserved across mammals). …
  • Effect Of Mutation On Codon
    written by Gvj Gvj
    <p>Hi All, Do you know any general scoring method/matrix which can give a score to a mutation based on its probability to change amino acids …