This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Cannot distinguish R1 or R2

Hello everyone,

I am downloading FASTQ files from SRA Explorer for the dataset GSE182256. After downloading the FASTQ file, I encountered a problem: I cannot distinguish between the R1, R2, or I1 files in the downloaded FASTQ file. I am wondering how to deal with this situation.

The file names are:

SRR15500524_GSM5525832_Control2_scRNAseq_Mus_musculus_RNA-Seq.fastq.gz
SRR15500525_GSM5525832_Control2_scRNAseq_Mus_musculus_RNA-Seq.fastq.gz
SRR15500526_GSM5525832_Control2_scRNAseq_Mus_musculus_RNA-Seq.fastq.gz
SRR15500527_GSM5525832_Control2_scRNAseq_Mus_musculus_RNA-Seq.fastq.gz
SRR15500528_GSM5525832_Control2_scRNAseq_Mus_musculus_RNA-Seq.fastq.gz
SRR15500529_GSM5525832_Control2_scRNAseq_Mus_musculus_RNA-Seq.fastq.gz
SRR15500530_GSM5525832_Control2_scRNAseq_Mus_musculus_RNA-Seq.fastq.gz
SRR15500531_GSM5525832_Control2_scRNAseq_Mus_musculus_RNA-Seq.fastq.gz

Thanks,

fastq
• 1,869 views • link
updated by GenoMax GenoMax • written by Long • Long

something the side is in the read ,names.

show us

gunzip -c SRR15500524_GSM5525832_Control2_scRNAseq_Mus_musculus_RNA-Seq.fastq.gz | head -n 8

• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum 
gunzip -c SRR15500524_GSM5525832_Control2_scRNAseq_Mus_musculus_RNA-Seq.fastq.gz | head -n 8
@SRR15500524.1 NS500497:57:H27CKBGX2:1:22206:11449:8088/3
GCTGAGTAGTACTCCATTGTGTAGATCTACCACATTTTCTGTATCCATTCCTCTGTTGAGGGGCATCTGGGTTCCTTCCAGCTTCTGGCTATTATAAA
+
AAAAA6EEEEEEEEEEEEEEEE6EAA/EEEE<EA/EEEEEAEEAEAA/AEEEEE//</AE/EEEEAEEAEA/EEE/EEEA<AA/<6//AE/E</E/A<
@SRR15500524.2 NS500497:57:H27CKBGX2:1:21202:17645:20267/3
GCTATGCCTTTCATCTGGGATTAAAGGTGTGGTGGAACACACCTTTAATCTGGGCTACACCTTTTGCTGGAGACAATATAAGAACATTGGAAGAAGGG
+
AAA6/EEEEAEEEEEEEAEAEE/E/AEAEE6EEEEE//<EEE/AA/AEE<E<A/EEAEEE//AEE///A/A//</<E/<EEA/6/<AE/E6A//////
• 0 views • link
updated by GenoMax GenoMax • written by Long • Long

1 answer

Using fastq-dump --split-files I can see the three file types. How did you download your files? There should be three files per sample.

$ head -4 SRR15500524*.fastq
==> SRR15500524_1.fastq <==
@NS500497:57:H27CKBGX2:1:22206:11449:8088
GAAGGAAC
+NS500497:57:H27CKBGX2:1:22206:11449:8088
AAAAAEEE

==> SRR15500524_2.fastq <==
@NS500497:57:H27CKBGX2:1:22206:11449:8088
TTGACTTGTTAAGGGCTGTACCTTGT
+NS500497:57:H27CKBGX2:1:22206:11449:8088
AAAA//EEEEEAEEEAEEEEE/AEEE

==> SRR15500524_3.fastq <==
@NS500497:57:H27CKBGX2:1:22206:11449:8088
GCTGAGTAGTACTCCATTGTGTAGATCTACCACATTTTCTGTATCCATTCCTCTGTTGAGGGGCATCTGGGTTCCTTCCAGCTTCTGGCTATTATAAA
+NS500497:57:H27CKBGX2:1:22206:11449:8088
AAAAA6EEEEEEEEEEEEEEEE6EAA/EEEE<EA/EEEEEAEEAEAA/AEEEEE//</AE/EEEEAEEAEA/EEE/EEEA<AA/<6//AE/E</E/A<
• 0 views • link
written by GenoMax GenoMax

What I do using SRA explore website, I enter the SRR15500524 into searching bar, and then download the fastq file by using curl.

• 0 views • link
written by Long • Long

Unfortunately with single cell data things tend to be all over the place in SRA. You may have to use fastq-dump if sra-explorer is giving you a single link. You basically have just the RNA read (file 3).

• 0 views • link
written by GenoMax GenoMax

Yes, i think So. Since GSE web said there are 3 file. But based on this how to determine R1, R2 and I1? Thanks for help.

• 0 views • link
written by Long • Long

Notice the /3 in your example above

@SRR15500524.2 NS500497:57:H27CKBGX2:1:21202:17645:20267/3

that says it is the third piece. Perhaps /1 and /2 are in the one file you have.

• 0 views • link
written by GenoMax GenoMax

Thanks for your replies. I use prefetch downalad the SRA file, and after it I use fastq-dump to split .sra file into 3. However, again I still have trouble to distinguish which one is R1, R2 or I1. The name of file looks like:

SRR15500516_1.fastq SRR15500516_2.fastq SRR15500516_3.fastq.

• 0 views • link
written by Long • Long

_1 = I1 = Illumina index (not needed for analysis)
_2 = R1 = Cell barcode + UMI
_3 = R2 = RNA read.

If you are planning to use cellranger you will need to rename the files per its requirements (see How to rename fastqs for cell ranger ? ).

• 0 views • link
written by GenoMax GenoMax

Thank you so much!

• 0 views • link
written by Long • Long

Log in to answer this question.

More posts like this