Question

What is wrong with my NCBI esearch command for 16S rRNA?

0

Entering edit mode

7 months ago

Morgan S. ▴ 90

Hi there,

I am trying to extract the 16S rRNA from my genomes using the genome accession from NCBI. I tried the code below and ended up with the same unrelated sequence for each of my accessions. Instead of the rRNA for each respective genome, in each output file I have the same sequence mapping to Wolbachia. Any suggestions or is this too ambitious?

for i in $(cat genome_list.txt); do esearch -db assembly -query ${i} < /dev/null | elink -target nuccore -name assembly_nuccore_insdc | elink -target protein | esearch -db protein -query '"16S rRNA"[Protein name]' | efetch -format fasta_cds_na > ${i}_16S.fa ; done

16S NCBI Entrez assembly • 1.1k views

ADD COMMENT • link updated 7 months ago by GenoMax 141k • written 7 months ago by Morgan S. ▴ 90

0

Entering edit mode

Probably not exactly what you are looking for but try:

$ esearch -db nuccore -query "PRJNA33317 OR PRJNA33175 " | efetch -format fasta

ADD REPLY • link 7 months ago by GenoMax 141k

0

Entering edit mode

Do you have one or two of the genomes in the list? Just want to try out the command; I've been bitten by Entrez being fiddly with quotation marks and it always takes me some debugging runs to find them

ADD REPLY • link 7 months ago by Philipp Bayer 8.3k

0

Entering edit mode

While the following seems to work (E coli genome) the command does not work reliably (at lest for me, it spits up a bunch of errors on multiple tries, following is a successful run sans errors).

$ esearch -db assembly -query 'GCA_000005845' | elink -target nuccore -name assembly_nuccore_insdc | elink -target protein | esearch -db protein -query '"16S rRNA"[Protein name]' | efetch -format fasta_cds_na
>lcl|BMAO01001414.1_cds_GFQ73155.1_1 [gene=rsmD] [locus_tag=TNCT_542461] [protein=16S rRNA] [protein_id=GFQ73155.1] [location=join(3724..3973,6076..6272)] [gbkey=CDS]
ATGGTAGATTCAGACTATTACAATTTACAATTACCTAAAAAAACAGCAGAAGATTTTGGAATTATGGACA
ATGTTACGCTAATTTGCTGCAGTGCTAACGGATTACCAAAACCTATTTCAAAATGCGACATAGTTTTTAT

ADD REPLY • link 7 months ago by GenoMax 141k

0

Entering edit mode

Hi GenoMax

This is what I am seeing as well. You provided an E. coli genome, but the 16S sequence is for a different entry, Trichonephila clavata. https://www.ncbi.nlm.nih.gov/protein/GFQ73155.1/

And when I provide a list, I get this same entry for them all. So it seems to not be the loop, but something with piping the different commands.

ADD REPLY • link 7 months ago by Morgan S. ▴ 90

0

Entering edit mode

You can feed in starts and stops below to recover the actual sequence

(Ignore the column with all 9's below).

$ esearch -db assembly -query 'GCA_000005845' | elink -target nuccore | elink -target gene | efilter -query 'rRNA' | esummary  |xtract -pattern DocumentSummary -element Name,Description,ChrAccVer,ChrStart,ChrStop | grep "ribosomal RNA"
rrsB    16S ribosomal RNA       NC_000913.3     4166658 999999999       4168199
rrsD    16S ribosomal RNA       NC_000913.3     3428761 999999999       3427220
rrsE    16S ribosomal RNA       NC_000913.3     4208146 999999999       4209687
rrsG    16S ribosomal RNA       NC_000913.3     2731156 999999999       2729615
rrsH    16S ribosomal RNA       NC_000913.3     223770  999999999       225311
rrsC    16S ribosomal RNA       NC_000913.3     3941807 999999999       3943348
rrlB    23S ribosomal RNA       NC_000913.3     4168640 999999999       4171543
rrlG    23S ribosomal RNA       NC_000913.3     2729183 999999999       2726280
rrlE    23S ribosomal RNA       NC_000913.3     4210042 999999999       4212945
rrlD    23S ribosomal RNA       NC_000913.3     3426782 999999999       3423879
rrlH    23S ribosomal RNA       NC_000913.3     225758  999999999       228661
rrlC    23S ribosomal RNA       NC_000913.3     3943703 999999999       3946606
rrfB    5S ribosomal RNA        NC_000913.3     4171636 999999999       4171755
rrfE    5S ribosomal RNA        NC_000913.3     4213039 999999999       4213158
rrfC    5S ribosomal RNA        NC_000913.3     3946699 999999999       3946818
rrfG    5S ribosomal RNA        NC_000913.3     2726187 999999999       2726068
rrfH    5S ribosomal RNA        NC_000913.3     228755  999999999       228874
rrfF    5S ribosomal RNA        NC_000913.3     3423541 999999999       3423422
rrfD    5S ribosomal RNA        NC_000913.3     3423786 999999999       3423667
rrsA    16S ribosomal RNA       NC_000913.3     4035530 999999999       4037071
rrlA    23S ribosomal RNA       NC_000913.3     4037518 999999999       4040422
rrfA    5S ribosomal RNA        NC_000913.3     4040516 999999999       4040635

Another option

$ esearch -db assembly -query 'GCA_000005845' | elink -target nuccore | elink -target gene | efilter -query 'ribosomal RNA' | esummary  |xtract -pattern DocumentSummary -element Name,Description -block GenomicInfo -element ChrAccVer,ChrStart,ChrStop 
rrsB    16S ribosomal RNA       NC_000913.3     4166658 4168199
rrsD    16S ribosomal RNA       NC_000913.3     3428761 3427220
rrsE    16S ribosomal RNA       NC_000913.3     4208146 4209687
rrsG    16S ribosomal RNA       NC_000913.3     2731156 2729615
rrsH    16S ribosomal RNA       NC_000913.3     223770  225311
rrsC    16S ribosomal RNA       NC_000913.3     3941807 3943348
rrlB    23S ribosomal RNA       NC_000913.3     4168640 4171543
rrlG    23S ribosomal RNA       NC_000913.3     2729183 2726280
rrlE    23S ribosomal RNA       NC_000913.3     4210042 4212945
rrlD    23S ribosomal RNA       NC_000913.3     3426782 3423879
rrlH    23S ribosomal RNA       NC_000913.3     225758  228661
rrlC    23S ribosomal RNA       NC_000913.3     3943703 3946606
rrfB    5S ribosomal RNA        NC_000913.3     4171636 4171755
rrfE    5S ribosomal RNA        NC_000913.3     4213039 4213158
rrfC    5S ribosomal RNA        NC_000913.3     3946699 3946818
rrfG    5S ribosomal RNA        NC_000913.3     2726187 2726068
rrfH    5S ribosomal RNA        NC_000913.3     228755  228874
rrfF    5S ribosomal RNA        NC_000913.3     3423541 3423422
rrfD    5S ribosomal RNA        NC_000913.3     3423786 3423667
rpsA    30S ribosomal subunit protein S1        NC_000913.3     961994  963667
rrsA    16S ribosomal RNA       NC_000913.3     4035530 4037071
rrlA    23S ribosomal RNA       NC_000913.3     4037518 4040422
rpsD    30S ribosomal subunit protein S4        NC_000913.3     3441674 3441054
rpsT    30S ribosomal subunit protein S20       NC_000913.3     21077   20814
rmf     ribosome modulation factor      NC_000913.3     1015714 1015881
rlmN    23S rRNA m(2)A2503 methyltransferase/tRNA m(2)A37 methyltransferase     NC_000913.3     2644282 2643128
suhB    Nus factor SuhB NC_000913.3     2663441 2664244
rrfA    5S ribosomal RNA        NC_000913.3     4040516 4040635
rhlE    ATP-dependent RNA helicase RhlE NC_000913.3     830871  832235
rsmI    16S rRNA 2'-O-ribose C1402 methyltransferase    NC_000913.3     3293334 3292474

ADD REPLY • link 7 months ago by GenoMax 141k

score 0 · Answer 1 · 2023-09-15

OK I think I got it now.

between here:

esearch -db assembly -query 'GCA_000005845' | \
elink -target nuccore -name assembly_nuccore_insdc | \ 
elink -target protein | \

and here:

esearch -db protein -query '"16S rRNA"[Protein name]' | \
efetch -format fasta_cds_na

There is a break, the previous results before esearch get discarded. esearch begins anew. You can try this out yourself by manually entering that search term in Genbank:

https://www.https://www.ncbi.nlm.nih.gov/protein/?term=%2216S+rRNA%22%5BProtein+name%5D

You should get the same spider protein as above, it's just randomly the first result for your search term: https://www.ncbi.nlm.nih.gov/protein/2071305251

I learned this by adding efetch -format docsum to every step, beginning with the first one.

Here's what you could do instead with replacing esearch by efilter, but I'm sure there's a nicer way of doing this:

esearch -db assembly -query 'GCA_000005845' | \
elink -target nuccore -name assembly_nuccore_insdc | \
elink -target protein | \
efilter -query '16S[Title]' | \
efetch -format fasta > all_my_16S_proteins.fasta

It's not perfect yet - I do get several proteins, but all of them at least have 16S in their title, and all of them come from that group of assemblies (E. coli MG1655).