This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Fetch genomic region(s) from refseq genomes

I would like to fetch specified genomic regions from refseq genomes without having to download the full genome. The regions are previously identified with a hmmer search. To my understandment Ensembl does not have all Refseq genomes. Many thanks, D

ensembl
• 1,398 views • link
updated by GenoMax GenoMax • written by usr2 • usr2

2 answers

Using EntrezDirect.

One thing to be aware of : If you use a top level RefSeq accession for bacterial genomes there may be multiple plasmids etc in that accession. Sequences may be retrieved from those as well. You may need to eliminate some of those sequences (example below).

$ esearch -db assembly -query GCF_017165115 | elink -target nuccore | efetch -format fasta -seq_start 20000 -seq_stop 20050
>NZ_CP062740.1:20000-20050 Escherichia coli O157:H7 strain Z1723 plasmid pZ1723-1, complete sequence
CATCCGCTTGCAGCACACCGCTGAAGCAGGCAAGATGAGTCTGCGGATGGA
>NZ_CP062739.1:20000-20050 Escherichia coli O157:H7 strain Z1723 chromosome, complete genome
ACATACATTAAGCCTTAATTTTCCTCTGACAACGGTCAGTGCAGCAAACAA
>CP062740.1:20000-20050 Escherichia coli O157:H7 strain Z1723 plasmid pZ1723-1, complete sequence
CATCCGCTTGCAGCACACCGCTGAAGCAGGCAAGATGAGTCTGCGGATGGA
• 0 views • link
written by GenoMax GenoMax

samtools can retrieve sequences without downloading the full genome.

eg.

samtools faidx https://igv.genepattern.org/genomes/seq/hg19/hg19.fasta chr21:10,000,000-10,000,020
• 0 views • link
written by barslmn • barslmn

Log in to answer this question.

More posts like this