Confusion about transcript ablation
I'm analyzing the WES data of a patient, after calling variants by GATK, I use Ensembl Variant Effect Predictor (VEP) to annotate my vcf file.
Here is one record from the output file:
#Uploaded_variation Location Allele Gene Feature Feature_type Consequence cDNA_position CDS_position Protein_position Amino_acids Codons Existing_variation Extra
chr11_64341844_GTTGTGGTCTGAGGTCTTGGGCCATCAGTGATGTCACAACCAGATGGCCCAAGACCCCAGACCACAACCCCATGTCTGGT/- chr11:64341844-64341923- ENSG00000278359 ENST00000615925 Transcript transcript_ablation- - - - - IMPACT=HIGH;STRAND=-1;SOURCE=Ensembl;GIVEN_REF=GTTGTGGTCTGAGGTCTTGGGCCATCAGTGATGTCACAACCAGATGGCCCAAGACCCCAGACCACAACCCCATGTCTGGT;USED_REF=GTTGTGGTCTGAGGTCTTGGGCCATCAGTGATGTCACAACCAGATGGCCCAAGACCCCAGACCACAACCCCATGTCTGGT
You can see, it says, chr11:64341844-64341923, there is a transcript ablation, and its impact is __HIGH__.
On Esembl's website, it says:
transcript ablation: A feature ablation whereby the deleted region includes a transcript feature
But, when I use Integrative Genomics Viewer to view this region, everything seems OK there.
I'm unsure if this is a false alarm or if I misunderstood the term.
For any help, thanks in advance.
Appendix:
Note: I use hg38 as reference genome through all of my work.
The header of VEP output:
## ENSEMBL VARIANT EFFECT PREDICTOR v110.1
## Output produced at 2023-08-22 10:55:53
## Connected to homo_sapiens_core_110_38 on ensembldb.ensembl.org
## Using cache in ~/.vep/homo_sapiens_merged/110_GRCh38
## Using API version 110, DB version 110
## ensembl version 110.584a8f3
## ensembl-variation version 110.d34d25e
## ensembl-io version 110.b1a0d57
## ensembl-funcgen version 110.24e6da6
## HGMD-PUBLIC version 20204
## sift version 6.2.1
## 1000genomes version phase3
## refseq version 110 - GCF_000001405.40_GRCh38.p14_genomic.gff
## COSMIC version 97
## ClinVar version 202301
## regbuild version 1.0
## genebuild version 2014-07
## dbSNP version 154
## assembly version GRCh38.p14
## gnomADg version v3.1.2
## gencode version GENCODE 44
## gnomADe version r2.1.1
## polyphen version 2.2.3
## Column descriptions:
## Uploaded_variation : Identifier of uploaded variant
## Location : Location of variant in standard coordinate format (chr:start or chr:start-end)
## Allele : The variant allele used to calculate the consequence
## Gene : Stable ID of affected gene
## Feature : Stable ID of feature
## Feature_type : Type of feature - Transcript, RegulatoryFeature or MotifFeature
## Consequence : Consequence type
## cDNA_position : Relative position of base pair in cDNA sequence
## CDS_position : Relative position of base pair in coding sequence
## Protein_position : Relative position of amino acid in protein
## Amino_acids : Reference and variant amino acids
## Codons : Reference and variant codon sequence
## Existing_variation : Identifier(s) of co-located known variants
## Extra column keys:
## IMPACT : Subjective impact classification of consequence type
## DISTANCE : Shortest distance from variant to transcript
## STRAND : Strand of the feature (1/-1)
## FLAGS : Transcript quality flags
## REFSEQ_MATCH : RefSeq transcript match status
## SOURCE : Source of transcript
## REFSEQ_OFFSET : HGVS adjustment length required due to mismatch between RefSeq transcript and the reference genome
## GIVEN_REF : Reference allele from input
## USED_REF : Reference allele as used to get consequences
## BAM_EDIT : Indicates success or failure of edit using BAM file
## CHECK_REF : Reports variants where the input reference does not match the expected reference
## REVEL : Rare Exome Variant Ensemble Learner
## CADD_PHRED : PHRED-like scaled CADD score. CADD is only available here for non-commercial use. See CADD website for more information.
## CADD_RAW : Raw CADD score. CADD is only available here for non-commercial use. See CADD website for more information.
• 1,989 views
•
link
0 answers
No answers yet.
Log in to answer this question.
Is it just one allele affected?
I would advise running the variant through the Ensembl VEP web interface tool: https://www.ensembl.org/Tools/VEP
From the results page, you can click on the genomic coordinates to navigate towards the Ensembl region view, which will automatically contain a 'VEP result' track. You can examine this view to see which transcript is affected and how the deletion overlaps it.