This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Kallisto bustools for scRNA-seq

Hi,

I followed several tutorials about single cell rna-seq analysis for paired end. However, I need to quantify single ends scRNA-seq dataset. I have used for paired ends. Does anyone know how to use kallisto scrna-seq for single ends? I am open to other suggestions. Thank you.

kallisto

It is a MARS-seq and processed as single end. The dataset is not public yet. I quantified scRNA for paired end by kallisto. However, I could not find option for single end:https://pachterlab.github.io/kallisto/manual

What is the library structure for MARS-seq?

It's fine if the technology only has one read file, but you need to know where the UMIs and barcodes are.

For example, if it's a 4bp UMI (aka locations 0-4) followed by a 6bp barcode (aka locations 4-10), followed by the actual biological sequence (location 10 onward), you'd input the following as the -x option:

-x 0,4,10:0,0,4:0,10,0

Explanation: The format is barcode:umi:cDNA, and within each, you give file_number,position_1,position_2. Note that a) file numbers are zero-indexed, and b) setting 0 for position_2 means going to the end of the read.

Hi, It is quite similar. After -x should I only put the fastq file?

Yes, just put that fastq file (it'll be the same as any other kallisto bustools run, except you have just one fastq file and you have that custom -x option)

@SRR17050039.1 NB501465:544:HF2H7BGXB:1:22104:14442:1233_TCCTGAGC_barcode=NA-EEEE-AAAAAEE-EEEEEEEE-GCTG-TGCCAGA-ACGTTCAT-W202012/1 GCCCTGTAATTGGAATGAGTCCACTTTAAATCCTTTA + EEEEEEEEEEEEEE/EEEEEAEEEEEEE6EEEEEEEE @SRR17050039.2 NB501465:544:HF2H7BGXB:1:22104:12136:1233_TCCTGAGC_barcode=NA-EEEE-AAAAAEE-EEEEEEEE-GCTG-GACACCT-ATTGTTTG-W202303/1 GTCCCCAGCGCTTCCCCAATGCCCAGCGGGCCTTTGC +

Could you help me to how to set -x for that one? Then I will be understanding for my files. Thanks

I have no idea what that is besides a bunch of jumbled sequences. You'll need look up the structure of the reads / library from wherever you got the sequencing done. I can't read a bunch of letters and tell you what it's supposed to be.

0 answers

No answers yet.

Log in to answer this question.