Remove part of headers in FASTA file
I want to delete the part starting after "CDS" until "p". And the characters between CDS and p vary.
I have a header like this:
>Eindica.01T000001.1 CDS=1-201_p
ATGACTAGGGAACGTGGACGACCAGCAAGGGCTTGGAAGCCAAGGCAGGGATTAG
>Eindica.01T000002.1 CDS=1-3027_p
ATGACCTTCTATGGATACACACAACACTCCTTAA
>Eindica.01T000005.1 CDS=577-4218_p
CCAAGGCCAAAAAATACATTTCTAAGGCCAAAGCTTGGCTTGAATGAATCTTGA
and I want to keep the header like this:
>Eindica.01T000001.1
ATGACTAGGGAACGTGGACGACCAGCAAGGGCTTGGAAGCCAAGGCAGGGATTAG
>Eindica.01T000002.1
ATGACCTTCTATGGATACACACAACACTCCTTAA
>Eindica.01T000005.1
CCAAGGCCAAAAAATACATTTCTAAGGCCAAAGCTTGGCTTGAATGAATCTTGA
Can someone help me with a solution? Would be great. Thank you.
1 answer
Use seqkit
seqkit replace -p " .+$" -r "" test.fasta
Where -p is the pattern (regex) and -r is the replacement pattern (in this case it's empty string)
Log in to answer this question.
More posts like this
-
Blog: NGS one-liner to call variants
written by barslmn •
-
How can I randomly choose and delete a set number of nucleotides from a fasta file?
written by Jonathan •
-
Duplicate fasta header and append it with a pipe
written by bionix •
-
Split multifasta-file into multiple files according to a pattern in header
written by 6schulte •
-
Remove part of headers in FASTA file
written by peterlageweg603 •
-
Tutorial: Which human reference genome should I use?
written by finswimmer
-
Trim FASTA header in multifasta file
written by j.m.carsten •
-
bwa aln. Reads align to 'N' characters in reference file.
written by izaak.coleman1 •
-
EBSeq explained to a biologist
written by Rik Verdonck •
-
Meme: What is the optimal sequence length?
written by BioinfGuru
Use
cut -d ' '