This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Align PCR-amplified sequences to two amplicons to get statistics of alignment?

Hello,

I have PCR-amplified a specific region that will either align to amplicon #1 or #2 dependent on what type of virus infection. What is the best way to run my fastq files against two amplicons and get the percentage that aligned to #1 versus #2.

Thank You, Sara

pcr alignment amplicon

What is the size of these amplicons? Are you only looking for full length alignments? What sequencing tech (long/short reads) are these from? Is there any sequence similarity between amplicons?

I am working with Illumina paired-end adapter sequences spiked-in on a 2X150 run. The two reference amplicons are 173 and 179 bp and have similarities so I would need to be stringent in allowed mismatches I suppose.....

1: aaaaagtataaatataggaccaggcagagcattttatacaacaggagaaataataggagatataagacaagcacattgtaaccttagtagagcaaaatggaatgacactttaaataagatagttataaaattaagagaacaatttgggaataaaacaatagtctttaagcact

2: aaaaagtatccgtatccagaggggaccagggagagcatttgttacaataggaaaaataggaaatatgagacaagcacattgtaacattagtagagcaaaatggaatgccactttaaaacagatagctagcaaattaagagaacaatttggaaataataaaacaataatctttaagcaat

We want to know if one virus wins over another in infection based off of the differences between these two sequences; so essentially the percentage that align best to #1 and the percentage that align best to #2.

I think you can try to create a long representation from PE data (these should overlap since your amplicon is only ~170 bp) by using a tool like bbmerge.sh or FLASH and then align the single read to the two amplicons independently. You will need to play with stringency parameters to test alignments.

Try bbmap.sh out and adjust minid= option when you align.

Thank You for the advice!

0 answers

No answers yet.

Log in to answer this question.