This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How do you decide to set the run to SE or PE on trimmomatic?

How do you decide to set the run to SE or PE on trimmomatic?

next-gen rna-seq

I ran this command and it was successful in trimmomatic but there is no trimmomatic-logs folder in the results. What am I missing?

java -jar /path/to/trimmomatic-0.39.jar \
  PE -trimlog trimlog_20191205.B-2744XJ_3.txt 20191205.B-2744XJ_3_1.fastq.gz 20191205.B-2744XJ_3_2.fastq.gz \
  SRR2589044_1.trim.fastq.gz SRR2589044_1un.trim.fastq.gz \
  SRR2589044_2.trim.fastq.gz SRR2589044_2un.trim.fastq.gz \
  SLIDINGWINDOW:4:20 MINLEN:25 ILLUMINACLIP:TruSeq3-PE.fa:2:40:15

TrimmomaticPE: Started with arguments:
  -trimlog trimlog_20191205.B-2744XJ_3.txt 20191205.B-2744XJ_3_1.fastq.gz 20191205.B-2744XJ_3_2.fastq.gz SRR2589044_1.trim.fastq.gz SRR2589044_1un.trim.fastq.gz SRR2589044_2.trim.fastq.gz SRR2589044_2un.trim.fastq.gz SLIDINGWINDOW:4:20 MINLEN:25 ILLUMINACLIP:TruSeq3-PE.fa:2:40:15
Multiple cores found: Using 4 threads
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'
ILLUMINACLIP: Using 1 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Quality encoding detected as phred33
Input Read Pairs: 266245409 Both Surviving: 222729178 (83.66%) Forward Only Surviving: 37659701 (14.14%) Reverse Only Surviving: 3517537 (1.32%) Dropped: 2338993 (0.88%) 
TrimmomaticPE: Completed successfully

Please do not post output of commands as answers. Answers are meant to be NEW answers for the original question at the top of the post.

It is tempting to ask for help for every small thing but there is a learning process that needs to happen. Bioinformatics is not just running commands but it is also about understanding what the program does with its options. Experiment and try things out. When you have specific questions or run into issues ask. We are here to help.

1 answer

If you have two FASTQ files per sample (e.g., something_R1.fastq and something_R2.fastq), then you have paired end (PE) reads. If you have only one FASTQ file per sample (e.g., something_R1.fastq only), then you have single end (SE) reads.

You call Trimmmomatic on whatever data you have (SE or PE). There really isn't much of a choice here unless you're going to discard one of the read pairs from a PE sequencing run.

Thank you!!

Do you know how to decide between phred33 and phred64?

Most current data should be phred33 format. Old (6+ years) data may be in phred64 format. You can use testformat.sh from BBMap suite if you are not sure.

Thank you for your response!!! Do you have any idea on how to decide which parameter to change for more quality results while trimming with Trimmomatic?

That will change with every dataset. If you have checked FastQC report then that will give you some guidance. For starters you can simply use the default recommended by trimmomatic manual. They should generally be sufficient.

Honestly, just use fastp instead. Should be much easier to use.

Use the default settings which are optimized unless you have a good reason to change them, which is almost never the case.

There really isn't much of a choice here unless you're going to discard one of the read pairs from a PE sequencing run.

If one has PE data then the files should be trimmed together to keep reads in sync post-trimming.

I decided on PE. I mean in general. Out of these parameters.

PE [-version] [-threads <threads>] [-phred33|-phred64] [-trimlog
<trimLogFile>] [-quiet] [-validatePairs] [-basein <inputBase> |
<inputFile1> <inputFile2>] [-baseout <outputBase> | <outputFile1P>
<outputFile1U> <outputFile2P> <outputFile2U>] <trimmer1>...

We are having trouble trimming the adapters properly, so what would you suggest which parameter I can change to experiment?

We are having trouble trimming the adapters properly

What made you decide that is the case? You should generally know from the kit used to prepare the libraries what kind of adapters your data has.

Your data does not NEED to have adapters present. Only if the length of sequencing is longer than the insert size then the read will have read-through into adapter at 3'-end. Having no adapter sequence is a good sign.

Log in to answer this question.