This is a test version of Biostars. For the public version, visit https://www.biostars.org.
clarifying head-to-head and tail-to-tail inversions

I am seeing some tools ask for these two types of inversions (head to head or tail to tail), but most callers just produce one breakpoint for each inversion without specifying if it is head-to-head or tail-to-tail. but some callers don't make that distinction and i'm not sure how to extract them. for example, in one delly output i have the following variant:

15  48518173    INV00004531 T   <INV>   .   PASS    PRECISE;SVTYPE=INV;SVMETHOD=EMBL.DELLYv0.8.2;CHR2=15;END=50467460;PE=8;MAPQ=60;CT=3to3;CIPOS=-4,4;CIEND=-4,4;SRMAPQ=60;INSLEN=0;HOMLEN=3;SR=7;SRQ=1;CONSENSUS=TATTGCCACAAATGGATGTGTCAGAGGAGGTAATTAAACTTGTGACCCGCACCATCATTTTTGGGTTTTTGTTCATGAAATCCTTGCATAAGCCAATGTCTA;CE=1.96136;RDRATIO=0.710181;SOMATIC    GT:GL:GQ:FT:RCL:RC:RCR:CN:DR:DV:RR:RV   0/1:-20.9631,0,-99.9607:10000:PASS:274972:389731:252274:1:47:8:32:10    0/0:0,-12.3096,-141.967:123:PASS:275394:551246:254224:2:61:0:41:0

The connection type is 3to3 in this record. From what I assume, since this is an inversion, there should be a second breakpoint that is 5to5. Why isn't there a balancing record for this record or any record that i can find? Perhaps the second breakpoint is directly implied, but in that case, why does delly choose to produce both 5to5 and 3to3 connection types (their totals are in approximately the same proportion), instead of only 5to5 or only 3to3? Maybe I'm not understanding the difference of these types.

sv delly

1 answer

Only simple inversions have both types of paired-end clusters. In cancer you often find complex SVs and in that case these SV types just tell you the type of genomic adjacencies, as described here

thanks so much! the link you provided helps me to properly understand the terms in some of the papers i have been reading. makes sense that i can rarely find "balanced" inversions, as all my samples are in fact cancer.

Log in to answer this question.