This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How does one use rename in seqkit to change sequence labels

As a follow-up to an earlier question, I am trying to figure out how to use seqkit to change duplicated read names

Unfortunately, the documentation and help for rename are very limited, and I don't see how the example listed can be applied to a case like mine:

https://bioinf.shenwei.me/seqkit/usage/#rename

Specifically, if I have a fastq sequence where two different reads have the same name, what do I do to append an _N to the second occurrence of a name?

In other words, given file.fastq, what input and output arguments do I need to apply so that seqkit rename <some arguments> file.fastq <some arguments> outfile.fastq

Returns outfile fastq with duplicate names changes to <name>_N

seqkit
• 3,145 views • link
written by shpak.max • shpak.max

What have you tried? Create a model input from your FASTQ (with ~10 unique reads and maybe 1-2 duplicates) and test against it - the manual is pretty straightforward on how to use the tool. Pro-tip: Use the -n just in case. Try the -n with the examples below to see the difference:

echo -e ">a comment\nacgt\n>b comment of b\nACTG\n>a comment2\naaaa\n>a comment\nbbbbb"  | seqkit rename
echo -e ">a comment\nacgt\n>b comment of b\nACTG\n>a comment2\naaaa\n>a comment\nbbbbb"  | seqkit rename -n

Note that seqkit rename will not give you <full_name_line>_N but <id_part>_N <rest_of_name_line>.

• 0 views • link
written by Ram Ram

1 answer

Besides seqkit you can also use rename.sh from BBMap suite.

rename.sh in=<file> in2=<file2> out=<outfile> out2=<outfile2> addpairnum=t

Back to your seqkit question.

$ more test.fq
@HWI-D00:74:H1493:2:1101:1186:2441
TTTTCTGCTACACTTCGAAAAACATATGATTCGTCTTTTCAGTTAGTTAAATATGTCTATAAGATGCCATCAATTAAAAAAAGTAACTTCACTATAATCG
+
CCCFFFFFGHHHGIEIJIJJGIIJJJJJHIJIGGGIJJJIJIIIJJJJJJJIJJJGIJJEIIIJJJJFHGIFIIGHIHHHFDD@CDDEEDDDDDDDDEDD
@HWI-D00:74:H1493:2:1101:1186:2441
TTTTCTGCTACACTTCGAAAAACATATGATTCGTCTTTTCAGTTAGTTAAATATGTCTATAAGATGCCATCAATTAAAAAAAGTAACTTCACTATAATCG
+
CCCFFFFFGHHHGIEIJIJJGIIJJJJJHIJIGGGIJJJIJIIIJJJJJJJIJJJGIJJEIIIJJJJFHGIFIIGHIHHHFDD@CDDEEDDDDDDDDEDD

You will now do. It will add a _2 to duplicate name for second sequence at end of fastq header

$ seqkit rename test.fq
@HWI-D00:74:H1493:2:1101:1186:2441
TTTTCTGCTACACTTCGAAAAACATATGATTCGTCTTTTCAGTTAGTTAAATATGTCTATAAGATGCCATCAATTAAAAAAAGTAACTTCACTATAATCG
+
CCCFFFFFGHHHGIEIJIJJGIIJJJJJHIJIGGGIJJJIJIIIJJJJJJJIJJJGIJJEIIIJJJJFHGIFIIGHIHHHFDD@CDDEEDDDDDDDDEDD
@HWI-D00:74:H1493:2:1101:1186:2441_2 
TTTTCTGCTACACTTCGAAAAACATATGATTCGTCTTTTCAGTTAGTTAAATATGTCTATAAGATGCCATCAATTAAAAAAAGTAACTTCACTATAATCG
+
CCCFFFFFGHHHGIEIJIJJGIIJJJJJHIJIGGGIJJJIJIIIJJJJJJJIJJJGIJJEIIIJJJJFHGIFIIGHIHHHFDD@CDDEEDDDDDDDDEDD
• 0 views • link
written by GenoMax GenoMax

Thanks, this should work for me.

• 0 views • link
written by shpak.max • shpak.max

Log in to answer this question.

More posts like this