This is a test version of Biostars. For the public version, visit https://www.biostars.org.
convert BGI stLFR reads to 10x format

Hi,

I'm working on stLFR reads and would like to test cloudspades and other assembly tools on them. Most of thoses tools use 10x format for barcoded reads. do anyone have a script to convert barcode splitted stLFR reads into 10x like reads?

thank you in advance!

10x reads stlfr

What do you mean by 10x format?

bascally as much as I understand BGI and 10x use different format in the read header for the barcode information:

BGI stLFR look like:

@V100002302L1C001R017000000#0_0_0/1 0   1
TGTCTTCCTGGACAGCTGACATCCCTTTTGTTTTTCTGTTTGCTCAGATGCTGTCTCTTATACACATCTTAGGAAGACAAGCACTGACGACATGATCACC
+
FFFFFFFGFGFFGFDFGFFFFFFFFFFFGFFF@FFFFFFFFFFFF@FFFFFFFFFGGFFEFEFFFF?FFFFGFFFGFFFFFFFGFFEFGFGGFGFFFGFF

were #0_0_0 is the barcode information

and 10x will look like something like:

@V100002302L1C001R017000000 BX:Z:CAGGTATCAGCGTAAG-1
TGTCTTCCTGGACAGCTGACATCCCTTTTGTTTTTCTGTTTGCTCAGATGCTGTCTCTTATACACATCTTAGGAAGACAAGCACTGACGACATGATCACC
+
FFFFFFFGFGFFGFDFGFFFFFFFFFFFGFFF@FFFFFFFFFFFF@FFFFFFFFFGGFFEFEFFFF?FFFFGFFFGFFFFFFFGFFEFGFGGFGFFFGFF

Not familiar with stFLR reads but if #0_0_0 is a real barcode (which does not seem to be sequence based) then I am not sure how you can convert that to something like BX:Z:CAGGTATCAGCGTAAG-1.

Had you seen this: https://github.com/BGI-Qingdao/stlfr2supernova_pipeline

Sounds like this is what you are trying to do?

0 answers

No answers yet.

Log in to answer this question.