This is a test version of Biostars. For the public version, visit https://www.biostars.org.
convert position to start and end

Hello, I have a TSV file like this :

CHRM    POS     REF     ALT     CLINSIG TYPE    GENE    MC
1       861332  G       A       Uncertain_significance  single_nucleotide_variant       SAMD11:148398   SO:0001583|missense_variant
1       861336  C       T       Likely_benign   single_nucleotide_variant       SAMD11:148398   SO:0001819|synonymous_variant
X       41524689        A       G       Likely_benign   single_nucleotide_variant       CASK:8573       SO:0001819|synonymous_variant
X       41524690        GGTGTT  CACCTACGTCATTTATGTAGGA  Pathogenic      Indel   CASK:8573       SO:0001587|nonsense

Starting with a chromosome and position, I am trying to get chrom Start and chrom End values I have single nucleotide base changes and I also have insertions and deletions that can be multiple bases long.

For Snps, i think i can write : chrom Start = pos and End = pos, because i have in another file like this : ( so they just take start = end )

CHRM    Type    start   end     CLINSIG
13      single_nucleotide_variant       32972745        32972745        Benign
17      single_nucleotide_variant       61565892        61565892       Benign

But for indels I don't know how to do.

chromosome end vcf start position

Oh yes I'm sorry, I extract features from vcf file to tsv file. I will edit the question.

0 answers

No answers yet.

Log in to answer this question.