This is a test version of Biostars. For the public version, visit https://www.biostars.org.
fastq.gz download error

Hi all

I have been trying to download the fastq.gz data of ncbi geo using ENA archive but it is not downloading whenever I try to download

enter image description here

This kind of ERR file is produced I'm not understanding why such issue is happening initially when I was downloading it was working but now I don't know why this kind of file is produced

I tried to change the folder, even I tried to change some setting in my laptop but nothing works so please if anybody can help me out

Thanks

fastq rna-seq

you'll need to provide some more (crucial) information here: how are you downloading it? (program? OS?) , what is the error you get? ... things like that.

I m downloading it directly from ENA database Generated fastq files:FTP

And the operating system is windows 11

It's not the error but I can't download the fastq files whenever I try to download it this ERR file is produced

Are you trying to download this data using WiFi, or hard-wired Ethernet? At NCBI, the dataset is listed at 613 Mb, which is pretty big. In my experience, WiFi can be unreliable for downloading large files. I will often see big downloads fail repeatedly on WiFi, and then plug the machine into the cable and get the file in the first try. Reasons for failure include the quality of the connection or equipment, your distance from the router, the traffic on the local network, and even local environmental conditions. Ethernet tends to be much more reliable with very large files.

See https://www.howtogeek.com/217463/wi-fi-vs.-ethernet-how-much-better-is-a-wired-connection/

1 answer

This dataset appears to have been released just a few days back (20th May) so it may not be fully ready to download from ENA.

$ curl -L ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR163/098/SRR16351998/SRR16351998.fastq.gz -o SRR16351998_GSM5627759_DU145_A6_clone-empty_vector_control_1_Homo_sapiens_RNA-Seq.fastq.gz
  % Total    % Received % Xferd  Average Speed   Time    Time     Time  Current
                                 Dload  Upload   Total   Spent    Left  Speed
  0     0    0     0    0     0      0      0 --:--:-- --:--:-- --:--:--     0
curl: (9) Server denied you to change to the given directory

You may simply need to try after a time.

I was able to download from NCBI using fastq-dump. So you could go that route if you need the data now.

fastq-dump  -F SRR16351998


@NS500595:630:HFTNJBGXJ:1:11101:3126:1048_TGTCTN
TATATTGAGTATTTTAGGGAAGTCTTTAAAAGACTTGTTTTATATCTATAAATCTAGGTTATTACAAAT
+NS500595:630:HFTNJBGXJ:1:11101:3126:1048_TGTCTN
EE/AEEEEEEEE6EEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEAEAEEEEEEEEE/EAE
@NS500595:630:HFTNJBGXJ:1:11101:15054:1048_TTTAGN
TATACTTTGGTGTTGGATCAGGTACTGTGTCTGCTCATAAGTACTTGTGTCATCCAGAATGTTTTGTTT
+NS500595:630:HFTNJBGXJ:1:11101:15054:1048_TTTAGN

Log in to answer this question.