Hello,

I have data like this:

chrom   pos ref alt confirmation    predicted to confirm    DP  AD  AF  gc_5    gc_20   gc_50   MQ  GQ  WHR HPL-D   HPL-L   QUAL    QD  FS
1   45795004    G   A   present VRAI    102 56  0,5446  0,5455  0,5366  0,5446  60  99  1,237   5   2   1359,77 13,33   0,759
1   45795040    C   A   present VRAI    105 49  0,4667  0,4545  0,5122  0,5446  60  99  2,448   5   3   1159,77 11,05   1,568
1   45795040    C   A   present VRAI    198 94  0,4745  0,4545  0,5122  0,5446  60  99  2,448   5   3   2243,77 11,33   3,261

gc_5 : GC content within a 5-bp window. gc_20 : GC content within a 20-bp window. gc_50 : GC content within a 50-bp window.

and I want to calculate gc_5, gc_20, gc_50 for another data with all the fields (except gc content and ( WHR HPL-D HPL-L)) for all positions and chromosome . my data ( Tab Separated Value) :

CHRM    POS     REF     ALT     DP      AD      AF      MQ      GQ      QUAL    FS
1        10403   ACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC  A       38      6       0.5     42.37   99      119.73  15.714
1        10492   C       T       18      4       0.5     50.53   70      41.77   5.614

Is there any tool that can do this ? or a python code, R .. ?

Thank you for your help

Additional question:

if you have any idea on how to calculate this HPL-D, HPL-L