Hello everyone!

I found in an article that they used bedtools nuc to calculate : GC content within a 50-bp window, & GC content within a 1000-bp window.

When I try to read the manual of bedtools nuc I found this:

Usage:   bedtools nuc [OPTIONS] -fi <fasta> -bed <bed/gff/vcf>

Output format:

    The following information will be reported after each BED entry:
        1) %AT content
        2) %GC content

So I tried to run this command but I don't get the output that I want :

bedtools nuc -fi hg19.fasta -bed file.bed > output_bedtoolsnuc.tsv

#1_usercol      2_usercol       3_usercol       4_usercol       5_usercol       6_pct_at        7_pct_gc        8_num_A 9_num_C 10_num_G        11_num_T        12_num_N        13_num_oth      14_seq_len
1       133322   133323   ACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC/A        +       1.000000        0.000000        1       0       0
       0       0       0       1

How can I get gc_50 & gc_1000 by using bedtools nuc?

Thank you