Hi, I'm using blastn in BLAST 2.11.0 and it keeps failing for specific sequences for a reason that I'm yet to understand. Any lead on what he problem might be? The error message is

Error: NCBI C++ Exception:
T0 "/tmp/BLAST/2.11.0/gompi-2020b/ncbi-blast-2.11.0+-src/c++/src/serial/objistrasnb.cpp", line 499: Error: (CSerialException::eOverflow) byte 132: overflow error ( at [].[].gi)
T0 "/tmp/BLAST/2.11.0/gompi-2020b/ncbi-blast-2.11.0+-src/c++/src/serial/member.cpp", line 767: Error: (CSerialException::eOverflow) ncbi::CMemberInfoFunctions::ReadWithSetFlagMember() - error while reading seqid ( at Blast-def-line-set.[].[].seqid.[].[].gi)

Whenever that happens, BLAST stops and the job fails. By splitting the fasta file in individual sequences, I've managed to isolate two examples of sequences that work and don't. This sequence is fine:

>S11_66329
ACTTTGAGCAGGAATAATTGGAACATCTTTAAGATTAATAATTCGATTAGAGTTAGGAACACCATCATCACTTATTAACAATGATCAATTTTATAATTCTATTATTACAGCTCATGCTCTAGTAATAATTTTTTTTATAGTTATACCAATTATAATT

But this sequence produces the error:

>S11_66321
CATGTCTTATGCTATGGTAGTTTAACAGCAAGCGTTTACTTTTTTTAATGTGTAATTATAATTTCCATATGGTCTTATCAATTAAAAAACTTTTGTCATTGCTTGTCCAATGTAGGTCACTAAAATTGGTCGAGATGCAGTTCTGTATGTGGAGTCTTTGATTGAGTCTATTATGGGAGGATTGGAAGGGTTGATCAATATTCTGGATTCTGAT

Command ran is (with test.fna containing the two above sequences):

blastn -query test.fna -db /nfs/scratch/shared_spaces/blastdb/nt/nt_20220427/nt -out test -num_threads 8 -max_hsps 5 -max_target_seqs 1 -outfmt "6 qseqid sseqid pident length mismatch gapopen qstart qend sstart send evalue bitscore sscinames staxids"