This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Running blastn results in "Error: NCBI C++ Exception"

Hello.
I'm running the command

blastn -db nt -query input.txt -out OUTPUT.txt -remote

which yields the error message:

Error: NCBI C++ Exception:
T0 "/build/ncbi-blast+-S1iyIZ/ncbi-blast+-2.9.0/c++/src/serial/rpcbase.cpp", line 230: Error: ncbi::CRPCClient_Base::x_Ask() - Failed to receive reply after 3 tries

Here's a sample from the input file's content:

>CP002002 Listeria monocytogenes 10403S, complete genome
tgaaggcagctatttatatacgcgtatctactcaagaacaaatagagaattactctatac
aagctcaaactgaaaagctaacagccttgtgccgctcgaaggattgggatgtatacgata
ttttcatagacggcggatacagcggttcaaacatgaatcgccctgcgctaaatgaaatgc
taagtaaattacatgaaattgatgctgtagtcgtatatcgattagacagactatcccgct

Did anyone encountered such as error? I couldn't find a similar past issue.
Thanks.

blastn blast command-line
• 2,317 views • link
updated by GenoMax GenoMax • written by langziv • langziv

CP002002 Listeria monocytogenes 10403S, complete genome

Remote blast searches are not meant to search entire genomes.

Maximum allowed query length is a million bases for web blast, which I guess also applies to -remote option.

• 0 views • link
written by GenoMax GenoMax

1 answer

Its always good to search biostars for similar questions. This post has a similar error output and it is suggested that the version of Blast is out of date. The latest is 2.13 and you are using 2.9

• 0 views • link
written by Jack Tierney • Jack Tierney

Log in to answer this question.

More posts like this