Hi
I had around 10,0000 gene sequences in individual fasta files. I'd like to rename each file with their header name containing the gene name.
Original file
head 1.fasta
==> 1.fasta <==
> Gloriosasuperba; 8324-9004; -; atp6
ATGACAGTAAGCCTTTTTGACCAATTTATGAGCCCCACACTACTAGGCATCCCCCTGCTC
Modified file
head atp6.fasta
==> atp6.fasta <==
> atp6
ATGACAGTAAGCCTTTTTGACCAATTTATGAGCCCCACACTACTAGGCATCCCCCTGCTC
•
written
by
sunnykevin97
I would not rename the files, but write the contents into a new file, which is trivial with awk:
cat *.fasta | tr "\n" ";" | tr ">" "\n>" | awk -F ";" '{a="../outdir/$4.fasta" ; print ">"$4"\n"$5 > a}'
This quick n' dirty solution assumes that there are no extra linebreaks in the sequences of your FASTA files and that there is a "outdir" folder in the parent directory to write the files into. You can also write your output to the current directory, but then your input/output might get mixed, so I would avoid that.
I executed the awk in the directory, containing all the files.
I created dir with "out"
cat *.fasta | tr "\n" ";" | tr ">" "\n>" | awk -F ";" '{print ">"$4"\n"$5 > "../out/$5.fasta"}'
awk: cmd. line:1: (FILENAME=- FNR=1) fatal: cannot redirect to `../out/$5.fasta': No such file or directory
I slightly edited my initial reply since the direct redirect to a mix of string and field variable doesn't seem to work. So it is now assigned to a variable a for being written out.
But this doesn't explain the "No such file or directory" error, because it would have created a file with the name $5.fasta in the out directory instead. Did you create the out folder in the parent directory or as a subfolder in the current directory? I am almost sure that this was the problem. Try again after running mkdir -p ../out.
Thanks Matthias,
It generates a concatenated file ($5.fasta), that is true.
with a fixed string length
head -n 6 $5.fasta
> trnW(tga)
AGAGACTTAGGCTAATATAAAACCAAGAGCCTTCAAAGCCCTAAATGAAAGTGAAAATCC
> trnA(gca)
AAAGTTTTAGCTTAATTAAAGTGTCTGTTTTGCGTACAGAAGATGTGGGTTAGTGTCCTG
> trnN(aac)
TAGATGGAGGCTCCTTGGTTTGAGCGTTTAGCTGTTAACTAAGAGTTTGTAGGATCGAAG
> trnC(tgc)
AGTCCCATGGTGTAACATATAAGATTGCAAATCTTAAGACGCAGATTAATATTTGCTGGG
> atp6
GCTCTAGCTATTTCTCTTCCTTGATTAATATTCCCTGCCCCTTCAACTCGATGATTAAAT
> atp8
CTAATTATTCTTCCCCCTAAAGTGATTGCTCATACTTTCCCAAATGAACCAACCCTACAA
I'm looking for the whole sequence, how I do it ?
Further, the concatenated file needs to be splitted in to individual fasta files.
That is weird, because tr should call the corresponding command to replace the respective letters:
echo "DNA" | tr "D" "R"
RNA
But then let's go step by step and without using tr.
Does
cat *.fasta | paste - - | sed 's/;/\t/g'
give you
Gloriosasuperba 8324-9004 - atp6 ATGACAGTAAGCCTTTTTGACCAATTTATGAGCCCCACACTACTAGGCATCCCCCTGCTC
and
cat *.fasta | paste - - | sed 's/;/\t/g' | awk '{fields[NF] = NF};END{for(i in fields) print fields[i]}'
returns only 5?
Yes, you're right.
If you only have entries with 5 fields and the contents of each FASTA file are now on one line, this should then give you the desired output:
cat *.fasta | paste - - | sed 's/;/\t/g' | awk -F ";" '{a="../out/$4.fasta" ; print ">"$4"\n"$5 > a}'
If you have multiple sequences for the same gene (e.g. transcripts), then use >> a such that they are concatenated.
In the cmd, what does the tr $4 and $5 represents for ?
'{print ">"$4"\n"$5 > "../out/$5.fasta"}'
$4 and $5 are the respective columns.
echo "aaaa bbbb cccc dddd" | awk '{print $1 > $2; print $3 > $4}'
should give you the file bbbb with the content aaaa and the file dddd with the content cccc.
So what I am attempting is:
Log in to answer this question.
