This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Why is needed a genome reference when calling variants

If reads have been aligned in the alignment process, why do we need a reference genome when calling variants (for example with FreeBayes)? This is one of the things I never expected to see before exploring NGS bioinformatic pipelines for calling variants from FASTQ files.

ngs
• 1,458 views • link
updated by GenoMax GenoMax • written by ManuelDB ManuelDB

here is the sequence of a read:

CTTCAACAACGTCCACTCTTTCTGGAAAATCAATTGGTAGGAGAGAACAGTACATTTCACCATATGCAGA

can you tell me if there is a mutation, and where is it ? without reference.

• 0 views • link
written by Pierre Lindenbaum Pierre Lindenbaum

Thanks Pierre,

I thought stupidly that that information is in the BAM file when the read is aligned.

• 0 views • link
written by ManuelDB ManuelDB

I thought that that information is in the BAM file when the read is aligned.

The information is in the BAM file for each standalone read (not as an identified SNP). It is in the form of how nucleotides (if any) in the read differ from the reference region the read aligned to.

To get this BAM file, one needs to start with a reference, index it and then align sequence data to that index, isn't that the case?

• 0 views • link
written by GenoMax GenoMax

0 answers

No answers yet.

Log in to answer this question.

More posts like this