What is the differance between the two formats ?
I'm trying to make sequence alignment using blast, however, it keeps getting this error
Warning: Sequence contains no data Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning:
That's an example of my sample data file:
>SRR12802808.400000 400000 length=2907 TTGGTATGCTTCGTTCAGTTACGTACTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTTGCTTAACAAACAAGAAACAAGGGACTCTCTAAAACCAAAGTCTCACTAAGTTTAAAACACCCAAACAGACATATAATATCAGCACCAACAGAAAGCAATACATGCTTGC +SRR12802808.400000 400000 length=2907 %'4*,,-&.0:53496140900.8.1/$,),,.67783/01324664720834541/.7/886///:8011*0-+*+5;7.28;8;1;8/''((61//*%#0*65;42,/866487/:///9::/&07(0-5-.
and aligning it with chromosome 22
1 answer
You can't use fastq format data for blast searches. You will need to convert this data to fasta format. You can use reformat.sh from BBMap suite or seqtk fasta for this conversion.
Fasta format is simply as follows (> followed by identifier then sequence on second line):
>SRR12802808.400000 400000 length=2907
TTGGTATGCTTCGTTCAGTTACGTACTACTTGC
Fastq format includes a per base quality score (see more in Wiki article). There are 4 lines per sequence record.
@SRR12802808.400000 400000 length=2907
TTGGTATGCTTCGTTCAGTTACGTACTACTTGCCT
+SRR12802808.400000 400000 length=2907
%'4*,,-&.0:53496140900.8.1/$,),,.67
I got it now, thank you !
Log in to answer this question.