This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Sequence Alignment by Blast issue

I'm trying to make sequence alignment using blast, however, it keeps getting this error

Warning: Sequence contains no data Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning: Sequence contains no data Warning:

That's an example of my sample data file:

>SRR12802808.400000 400000 length=2907  TTGGTATGCTTCGTTCAGTTACGTACTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTTGCTTAACAAACAAGAAACAAGGGACTCTCTAAAACCAAAGTCTCACTAAGTTTAAAACACCCAAACAGACATATAATATCAGCACCAACAGAAAGCAATACATGCTTGC +SRR12802808.400000 400000 length=2907  %'4*,,-&.0:53496140900.8.1/$,),,.67783/01324664720834541/.7/886///:8011*0-+*+5;7.28;8;1;8/''((61//*%#0*65;42,/866487/:///9::/&07(0-5-.

and aligning it with chromosome 22

blast alignment
• 1,811 views • link
written by sara • sara

1 answer

You can't use fastq format data for blast searches. You will need to convert this data to fasta format. You can use reformat.sh from BBMap suite or seqtk fasta for this conversion.

• 0 views • link
written by GenoMax GenoMax

What is the differance between the two formats ?

• 0 views • link
written by sara • sara

Fasta format is simply as follows (> followed by identifier then sequence on second line):

>SRR12802808.400000 400000 length=2907  
TTGGTATGCTTCGTTCAGTTACGTACTACTTGC

Fastq format includes a per base quality score (see more in Wiki article). There are 4 lines per sequence record.

@SRR12802808.400000 400000 length=2907  
TTGGTATGCTTCGTTCAGTTACGTACTACTTGCCT
+SRR12802808.400000 400000 length=2907 
%'4*,,-&.0:53496140900.8.1/$,),,.67
• 0 views • link
written by GenoMax GenoMax

I got it now, thank you !

• 0 views • link
written by sara • sara

Log in to answer this question.

More posts like this