how to determine a fastq is phred+33 or phred+64

Hello everyone!

here is a simple question: If I got a fastq from public database, is it possible to determine whether its quality score is phred + 33 or phred + 64 based on the file itself?

Thanks!

Pei

rna-seq phred33 phred64

• 14,182 views • link

written 4.7 years ago by Pei

In Phred 64 files, you should not be seeing phred values <64. But you can also look at upper case and lower case of quality representations (ascii letters). In general, lower case means 64.

• 0 views • link

written 4.7 years ago by cpad0112

Thanks! I'll check that.

• 0 views • link

written 4.7 years ago by Pei

1 answer

There are many ways of doing it - see here.

• 0 views • link

written 4.7 years ago by Mensur Dlakic

Thanks!

I'll check these.

• 0 views • link

written 4.7 years ago by Pei

More posts like this

How to determine the encoding method of quality score in a fastq file?
written 3.7 years ago by octpus616 •

As you know, there are two general standards for the sequencing quality of fastq files: `Phred+33` and `Phred+64`. I have a very old fastq file …
STAR genomeSAindexNbases
written 4.8 years ago by Pei

Hello everyone! what is the exact meaning of the parameter genomeSAindexNbases which is used for building genome index by STAR? (the mannual says For small …
Abnormal fastq lines
written 5.1 years ago by jaqx008

Hello all, I obtained this SRA files from ncbi. Something appears to be off with the third lines and I am not sure what but …
fastq quality scores
written 8.4 years ago by nukkduko •

Hello everyone! I'm a little bit confused with fastq quality score. I've got fastq with reads like this: @EAS18:1:1:2:1642:1830:0/2 TGTCCCATCTCATGCTCAAGCAGCAGACGAAC + a`_^a_^a_aa^aa`a_`_a[[a^_aU__W^^Xa````^_`RER What is [phred …
Phred score check for BAM files
written 9.3 years ago by Shicheng Guo

Hi All, I finish a perl script to check the phred score for bam files. I just want to make sure there is no bugs …
Filtering sanger_fastq, illumina_fastq files using Fastx-Toolkit
written 11.3 years ago by bioinfo

I am doing some quality filtering of a large bunch of mixed fastq files produced from multiple versions of Illumina platforms. Thus, the quality scores …
Phred 33 and phred 64 scores mixed in .bam file
written 12.0 years ago by venks

Hi, I have a sample in my .BAM file which has phred score ranging from 1-66. The quality score distribution looks like there are two …
Fastx Invalid Quality Score Value
written 12.7 years ago by sckinta

I have multiple RNAseq libraries to parse, so I wrote a pipeline using bash and submitted them in batch. Most of libraries ran well and …
Bam-Readcount And Quality Score Encoding
written 13.5 years ago by loeblabstuff •

I'm curious if bam_readcount is sensitive to the quality score encoding (phred+33 vs phred+64). I've run across a situation in which bam_readcount calculates the average …
Fastq Format Confusion
written 13.7 years ago by Biomonika (Noolean)

Hi! In the following article <a href='http://file:///home/misa/Sta%C5%BEen%C3%A9/NGS_workshop_1_Intro.pdf'>The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants.</a> I found this table: …