I am trying to map short some specific short reads (19~20nts) against long reads of a fasta file (F1.fasta). I used Segemehl tool and indexed the F1.fasta file (long reads) and then used the command line below to perform the alignment:

segemehl.x -i F1_reads.idx -d F1.fasta -D 2 -q short_reads.fa > mymap_segemehl.sam

My problem is that with using -D 2 to allow detection of insertions or deletions, I do not get a hit for the example long read like below:

In my short reads, I do have ATGGTGCTACGACACTGGC as an entry and in mapping this short read against the long read below, I expect to get a hit in the SAM file because if you look at the end of the long read, that part completely matches with the short read (as highlighted by the ^__^__^ segment below) except that there is an insertion in the long read (C higlighted by the second ^).

>long_read_1
TCACATGTGTATAAGAGACAGATCAGCATTATTGACCTTCAGGCGTATGTGTGCAAGTAATGGTGCCTACGACACTGGCC
                                                           ^______^___________^

Could somebody help me with this? Maybe I am using the wrong option?

Thank you.