Tool that finds direct DNA repeats with mismatches
Is there an open source standalone tool that finds de novo direct interspersed DNA repeats in a small sequence and allows for mismatches? Something similar to repeat-match.
repeats
0 answers
No answers yet.
Log in to answer this question.
More posts like this
-
Tool to find chromosome specific repeats
written by giova34 1I'm looking for a tool to search for an unusual criteria of repeats. Specifically, I'm trying to find pseudo-repeats that are: 1. ~ 1000-2000 bp …
-
detection of inverted repeats of transposons in Bacteria
written by bas1993 6I found several transposase genes in a bacterial assembly and I now want to determine the size of the insertion sequence. In literature I read …
-
Tool to flip contigs the right orientation with respect to a reference sequence
written by Tonor 48Does anyone know a tool(s) that can flip contigs generated from a de novo assembly so that they are the correct orientation with respect to …
-
Where are examples of Interspersed repeats?
written by veronicaschroeder78 15Interspersed repeats are often defined as repetitive sequences dispersed throughout the genome. However such definition (IMO) does not exclude Tandem Repeat Sequences. So I started …
-
Aligning de-novo assembly to reference strain genome
written by aindap 12Dear Biostars Community - I generated a de-novo assembly of my viral strain. I wanted to analyze differences of my denovo result to a reference …
-
finding repeats in de-novo assembled contig from PacBio reads
written by aindap 12Dear BioStars Community: I performed a de-novo assembly of PacBio reads using [Canu][1] for a viral genome. I have my resulting unitig from the canu …
-
Tool: TRAL - Tandem Repeat Annotation Library
written by Elke Schaper 11For my Ph.D., I've implemented solutions to a large number of tasks related to sequence tandem repeats. We've now decided to make the code accessible …
-
Is there any open source assembly softwares that takes in de novo assembly generated contigs and re…
written by ajagannath.patro 2<p>Is there any open source assembly softwares that takes in de novo assembly generated contigs and reference genome to produce bigger contigs( reference guided de …
-
Alternetive to GoldenHelix GWAS
written by danielestrife 8Good morning, I need to know if there is an open-source alternative to [Golden Helix GWAS][1], do you know something similar but free-to-use? Thanks in …
-
Is There Is Tool For Variable Tandem Repeats Finding?
written by zeleniy.spb 3For example I have the next sequence: ``` ACGAGGTTACTACTACTAGTACTACGCC # _________^^^______ ``` As you can see there is a tandem repeat with monomer TAC. But …
Is that helpful? Searching Repeats And Palindromic Sequences In Dna Sequences
I saw that post already and it was very helpful. I went through the tools and that's how I found repeat-match via the MUMmer answer. Unless I'm mistaken, the only tool I found that matches what I'm looking for (direct interspersed repeats, not tandem or consecutive repeats) is REPuter but it requires a license for the standalone version. My sequence is small and not a genome. I'll add more details to my question.