Dear Bioinformatics,
I'm want to let you know that I'm stuck with a issue and it's as follows:
My goal is predict RNA secondary structures in Hepatitis virus and I want to employ RNALalifold from the ViennaRNA package with default parameters, to determine the boundaries of locally stable structures within each MSA, and realigned these local regions using mLocARNA.Then the significance and conservation of the found structures will be evaluated with RNAz.
Keeping in mind the above, the RNALalifold output is an alignment in Stockholm format as this:
# STOCKHOLM 1.0
#=GF ID aln_142_184
#=GF SS RNALalifold prediction
HEPATV_1 AACGTGAGTTTAGTAAAACCAACGGTTTACGTCTACTCGCGTG
HEPATV_2 AACGTGAGTTTAGTAAAACCAACGGTTTACGTCTACTCGCGTG
HEPATV_3 AACGTGAGTTTAGTAAAACCAACGGTTTACGTCTACTCGCGTG
#=GC RF AACGUGAGUUUAGUAAAACCAACGGUUUACGUCUACUCGCGUG
#=GC SS_cons .((((((((...(((((.((...)))))))....)))))))).
//
Note that at the bottom is the RNA boundaries of locally stable structures.
Now, I need to convert this alignment into CLUSTAL format, i.e within of the extension "aln", which it would serve as input in Mlocarna tool. This software only supports alignments with the aln extension (CLUSTAL) with its respective RNA boundaries at the bottom. For this reason, I would like to contact you if you know any tool, script or method to convert this alignment from STK to CLUSTAL with its respective RNA boundaries?
I will be very appreciative of any help you can give me
boundaries
structure
rna
Hi
Maybe someone who knows exactly what you are talking about could help you with a tool, script or method.
That being said, just in case no one else responds, could you provide an example what your input is and what your output should look like, please? Perhaps you know of a tutorial that has the inputs and outputs you could paste here.
I am asking this because it may be possible to just do this with terminal commands such as
awk,grep,cut... I could give it a try?-Pratik
Hi.
The output of the RNALalifold program is as shown in the example above and the input I need for Mlocarna is like this:
Hmm... I still don't understand the conversion completely... Maybe someone else could chime in?