I do not understand why dynamic programming algorithms can not detect this... for example, if I align a gene that has a sequence 5'->3' with an other that is 3'->5', Smith-Waterman algorithm is not able to do it ?
Hello.
I was reading this article about Whole-Genome Alignment and Comparative Annotation. I find difficult to understand this extract from the article that describes the cons of using Smith-Waterman algorithm for the alignment problem:
Another consideration is how genome rearrangements complicate the alignment problem. Smith–Waterman and Needleman–Wunsch both produce alignments that have fixed order and orientation; that is, insertions, deletions, and substitutions are the only allowed edit operations. When looking within short or well-conserved sequences, like genes, this requirement is usually fulfilled. But at large evolutionary distances and looking within a sufficiently large window, genomes almost always contain more complex rearrangements with respect to each other—inversions, transpositions, and duplications all cause breaks in order and orientation that cannot be captured under constant order and orientation.
My doubt is: what do they mean by "orientation" ?
2 answers
Hello there!
Normally when people talk about gene orientation, they are referring to whether the gene is encoded on the positive or negative strand of DNA.
I found a complimentary video that may help: https://www.youtube.com/watch?v=JC6ew2xnJBA
Well, there are expected inversions and translocations in a genome. A piece that was oriented as ---===>----> in a genome of one organism may be oriented as ---<====----> in another organism of the same specie. Dynamic programming algorithms can not detect this, obviously.
You can check it here https://www.ebi.ac.uk/Tools/psa/emboss_water/ (put DNA):
ACGACACGTAGCAGCATGCAGCATCATACAGCATCACAGTCAGTTTCAGCAGCAAACTACAGT
and its reverse
TGACATCAAACGACGACTTTGACTGACACTACGACATACTACGACGTACGACGATGCACAGCA
The result:
EMBOSS_001 1 ACGAC--------ACGTAGCAGCATGCAGCATCATACAGCA 33
||||| |||||..|..|||| ||||||
EMBOSS_001 31 ACGACATACTACGACGTACGACGATGC--------ACAGCA 63
Not really what we expect, true?
Log in to answer this question.