convert tabular data to fasta
Hello all,
I have a text file whose first column is the name of the transcript and the second column is the nucleotide sequence. My question is how to convert this text file to fasta in Linux ?
TCONS_00000128
CGTAACCTGAGGTTTATTCCGGATATGGCTCAGAGCAgtgatcattatcaaatgaGTTGTCAGCGTCAACAGTGATCTCGTTGAATTCTGGCATCCGGCAGCTGGTCTGGGGATTTCTGAAGA
TCONS_00000042
GATTGATGACCGTCGCCGAAGAGATAGTATTCCGGGTCCATTCGGCCTATACCGACGACGTTGACGGACTGGTGGCGATATAACTATCGAGGTTCCTCGTTCGAAGGTATCGGTTAT
2 answers
sed 's/^/>/;s/[ \t]/\n/' in.txt
• 0 views
•
link
written
by
Pierre Lindenbaum
$ seqkit -w 0 tab2fx <input.fa> -o <output.fa(.gz)>
$ awk -v OFS="\n" '{print ">"$1,$2}' test.txt
$ awk -v OFS="\n" '{$1=">"$1}1' test.txt
$ sed 's/^/>/;s/\t/\n/' test.txt
$ sed -r 's/^(.*)\t(.*)/>\1\n\2/' test.txt
$ parallel --colsep '\t' echo '\>'{1}'\\n'{2} :::: test.txt
Log in to answer this question.
More posts like this
-
Convertion of FASTA file to FASTQ file
written by sabreenaalam12345 •
-
Adding the csv file names as a separate column to the csv file
written by paramount.amin •
-
Removing white space from the beginning of the second field (sequence) in a fasta file
written by Angie11 •
-
How do transcript-level gene ontology
written by lkianmehr
-
bcftools roh: short way to put several samples from a merged VCF in the same column?
written by miqrom •
-
tab to fasta file conversion
written by blooming.daisy333 •
-
Mapping between gene IDs and transcripts IDs in C. elegans
written by biomagician
-
how to replace certain column name based on another file
written by wu.zhiqiang.1020 •
-
How to import fasta file by using perl DBI.?
written by Krithi.S •
-
Adding Domain Annotation Identifiers To Fasta Headers
written by elfeu •
