This is a test version of Biostars. For the public version, visit https://www.biostars.org.
how to use python to only read sequences from fasta files

Hi, I have a file like this: """

>chr1:875558-875877
ATGTAAAAATCCTCCTTTTT
>chr1:935274-935972
TGTCTGGGGTCCGGCTGGCGCT

""" I want to extract the seqences only but not the line with ">", how to do this?

sequencing python genome fasta

refer to SeqIO and SeqIO.parse from biopython.

0 answers

No answers yet.

Log in to answer this question.