This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Finding Adapters For Illumina Reads

Hi All

I have some illumina reads but I don't know which adapters has been used. How I can find if my illumina reads has adapters and of which type.

Best

fastqc

hi, I have the same problems, how do you resolve it?

4 answers

Hi,

imprt them into the FastQC program. Go for "overrepresented sequences" there should be stated which adaptors are used.

That will only happen if there is adapter contamination. Usually that is not the case, as people always try and sequence a fragment longer than the read length

FastQC only gave you warning when overrepresented sequences were in first 200,000 sequences. see FastQC documentation

Supposed read1.fastq and read2.fastq is the paired end data with 4 lines per read.

Download common Illumina adapters from https://github.com/vsbuffalo/scythe/blob/master/illumina_adapters.fa

Go through each adapter, e.g. sampling 1 million read1.fastq for truseq-forward-contam adapter:

cat read1.fastq | head -4000000 | grep AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC | wc -l 
cat read1.fastq | tail -4000000 | grep AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC | wc -l

If the above command output >100, then sampling 1 million read2.fastq for truseq-reverse-contam will output with similar number:

cat read2.fastq | head -4000000 | grep AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA| wc -l 
cat read2.fastq | tail -4000000 | grep AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA| wc -l

no need for cat imho:

head -4000000 read1.fastq | grep AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC | wc -l

In reference to the comment above, i tried the following commands:

cat read1.fastq | head -4000000 | grep <Adaptersequence> | wc -l 
cat read1.fastq | tail -4000000 | grep <Adaptersequence> | wc -l

on my fastq file and got different output numbers (2731 and 1818 respectively).

What does this signify?

Means your forward reads have 2731 adapters in them and reverse have 1818. The numbers do not have to be identical.

You can find the illumina adapters on the illumina website.

The link doesn't work.

Log in to answer this question.