This is a test version of Biostars. For the public version, visit https://www.biostars.org.
How To Run Phrap With Quality Score Input

I tried the following command:

./phrap/phrap.manyreads  Sample.fasta  Sample.qual -ace

But it failed:

phrap version 0.990329
FATAL ERROR: With current phrap version only one input sequence file may be specified

The Sample.fasta looked like this:

>chr17_4124679_4124041_1_0_1:0:1_3:0:0_0/1
ATTCTTCTAAACACTTTGGAGTATACGGTTGTGTGAATGTATTTAACCAGTTCTTCTTGAGGAACTTTGTGATTGT
>chr17_2975404_2976000_0_1_0:0:0_1:0:0_1/1
GATCACGCCATTTCATTTCAGCCTGGGTGAAAAAAGTAAAACTCTGTCTCAAAAAAAAATTTAAAAATTATAGTCA

and Sample.qual looked like this:

>chr17_4124679_4124041_1_0_1:0:1_3:0:0_0/1
37 36 40 39 19 20 40 26 40 40 40 40 40 40 40 40 34 40 34 40 40 40 40 6 40 18 13 23 22 15 9 10 11 36 40 34 15 3 17 9 23 20 19 30 22 26 36 22 20 10 12 9 7 3 5 10 0 40 18 7 3 20 4 7 10 10 3 5 8 10 10 6 4 1
>chr17_2975404_2976000_0_1_0:0:0_1:0:0_1/1
24 10 40 40 40 40 40 40 40 40 40 14 35 33 3 7 29 26 40 40 40 40 40 40 40 40 40 31 23 3 3 1 12 13 10 2 4 6 4 4 5 2 4 15 12 16 14 23 12 5 4 17 22 10 8 5 4 4 2 2 6 3 3 36 5 1 15 11 20 3 3 4 4 5 6 10

What's the right way to do it?

assembly quality
• 3,244 views • link
updated by Daniel Daniel • written by Pdubois • Pdubois

2 answers

Just named the quality file as the same as the the sequence file included ".fasta" or ".fa" or ".seq", and with the suffix of ".qual". Like this: Sample.seq Sample.seq.qual Then put them together in the same folder, and run: phrap.manyreads Sample.seq -new_ace > phrap.out

• 1 views • link
written by BENM • BENM

I always find it easier to cat all my individual reads into one .fas file (and corresponding .qual) and read that in with phrap. Depends on the numbers you're working with obviously.

• 1 views • link
written by Daniel Daniel

Log in to answer this question.

More posts like this