Reverse Strand And Genomic Position Numbering
1
0
Entering edit mode
11.1 years ago
Kritika • 0

A genomic position of a DNA sequence fragment on a chromosome is given and the orientation is specified as reverse strand
For example: GGCACGCATCAGCAGCTGCTGGCACAGAAA ; genomic position: 87133609 ; Orientation (-). Now, I have obtained a text file containing chromosome sequence and it is in forward direction and if I have to verify the position of the sequence fragment. I will have to search for the mirror repeat of the sequence. Am I right ? Thanks in advance for the help

• 5.1k views
ADD COMMENT
1
Entering edit mode
11.1 years ago
Ido Tamir 5.2k

In which format did you get the sequences? Your coordinates seem to have been given in 0-based system (unexpectedly for me), because your read aligns also to human hg19 chr7:87133610-87133639(-) in one based coordinates. And it indeed is given as the reverse complement of the reference strand (unexpectedly for me).

Unless the data comes in a well described or specified format (e.g. SAM/BAM, bed, gff) all bets are off. Even then sometimes the data is not correct (off by one errors, wrong orientation).

ADD COMMENT
0
Entering edit mode

First of all thanks for your reply. I am totally new to this field and working on a project, a part of which is to look at some DNA fragments that align with Human hg19 in this example it aligns with Chr 7 (as you pointed out). My boss has given me various textiles one of which is "chr7.fa" and it contains genomic sequence in forward direct (I assume). Also, I have been given few fragments in EXCEL file that has orientation written as either positive or negative and the genomic positions corresponding to it. If I do a search, I am able to find all the fragments which are recorded with a positive sign (that is I guess refers to forward direction) in the given genomic sequence. However, I am not able to find any fragment that is marked in EXCEL with a negative sign since I assume it must be on reverse strand. So, I have to find reverse complement of the fragment to locate the position of fragment in the genomic sequence; if the EXCEL file marks the fragment as being in the negative orientation. To clarify on your question I am not informed about the Dataset where the files are coming from. Also, I dont understand what is one based coordinates are. So my basic question was if the orientation is recorded as positive for a fragment then I can directly search the same fragment in the chromosome file (for example Chr7.fa) but if the recorded orientation is negative, I will have to look for reverse complement of the fragment? Thank you

ADD REPLY
0
Entering edit mode

Seems like it. The easiest is of course the use a mapping program, that searches on both strands automatically without you having to do anything. Convert the Excel to fasta and use blat. Or try galaxy.

ADD REPLY
0
Entering edit mode

Thanks a lot for the reply. I am writing a program in JAVA that takes this fragment as an input and aligns with the genomic sequence. However, if I use BLAT I will have to individually submit fragment each time and they are loads for example 20,000 in number. I dont know if there is any procedure where I can submit say 1000 fragments recorded in a text file or EXCEL file to BLAT where each fragment may align with different chromosome and I can get an output separately from BLAT. If that works then I can submit it 20 times and it will work still quicker I guess rather than writing a program. I am really thankful for all your help

ADD REPLY
0
Entering edit mode

then use galaxy: reformat to fasta, then align to hg19 with bowtie. Or do it on the command line.

ADD REPLY
0
Entering edit mode

Sorry for the trouble, but can you please elaborate on your comment and can I get help or any tutorial on how to perform the same it will be of great help. Thanks for the reply

ADD REPLY

Login before adding your answer.

Traffic: 1001 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6