How To Capture The Blast Result In A String Variable To Save In A Database Using Bioperl

I am trying to run RemoteBlast using the Bio::Tools::Run::RemoteBlast object of BioPerl. Once the result is obtained, I know how to save it to a file as shown below:

while ( my @rids = $factory->each_rid ) {
    foreach my $rid ( @rids ) {
        my $result = $factory->retrieve_blast( $rid );  
        if ( ref( $result )) {
            my $output   = $result->next_result();
            my $filename = $output->query_name().".out";
            $factory->save_output( $filename ); 
            $factory->remove_rid( $rid );
            print "Result:",$output->query_name(),"\n";
        }
    }
}

However I want to save the result to a database. Please let me know how the result can be captured in a string variable so that it could be inserted into a table.

bioperl

• 3,903 views • link

updated 3.5 years ago by Ram

• written 13.3 years ago by Curious Mind •

2 answers

Tell BioPerl to save the result as XML.

I wrote a xslt stylesheet transforming a BLAST xml output to sqlite3 statements: https://github.com/lindenb/xslt-sandbox/blob/master/stylesheets/bio/ncbi/blast2sqlite.xsl

usage:

xsltproc --novalid   blast2sqlite.xsl  blast.xml |  sqlite3 blast.sqlite

then:

~$ sqlite3 -header -line blast.sqlite 'select * from Hit,Hsp where hsp.hit_id=hit.id ' | cut -c 1-80
          id = 1
iteration_id = 1
         num = 1
      hit_id = gi|118082669|ref|XM_416233.2|
         def = PREDICTED: Gallus gallus similar to ubiquitous tetratricopeptide 
   accession = XM_416233
         len = 2868
          id = 1
      hit_id = 1
         num = 1
   bit_score = 556.962
       score = 301.0
      evalue = 3.58957e-158
  query_from = 92
    query_to = 395
    hit_from = 2378
      hit_to = 2681
 query_frame = 1
   hit_frame = 1
    identity = 303
    positive = 303
        gaps = 0
   align_len = 304
        qseq = TACTAGATATGCAGCAGACCTATGACATGTGGCTAAAGAAACACAATCCTGGGAAGCCTGGAGAG
        hseq = TACTAGATATGCAGCAGACCTATGACATGTGGCTAAAGAAACACAATCCTGGGAAGCCTGGAGAG
     midline = |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

          id = 2
iteration_id = 1
         num = 2
      hit_id = gi|27881483|ref|NM_017590.4|
         def = Homo sapiens zinc finger CCCH-type containing 7B (ZC3H7B), mRNA
   accession = NM_017590
         len = 5868
          id = 2
      hit_id = 2
         num = 1
   bit_score = 366.757
       score = 198.0
      evalue = 6.49273e-101
  query_from = 100
    query_to = 390
    hit_from = 2608
      hit_to = 2898
 query_frame = 1
   hit_frame = 1
    identity = 264
    positive = 264
        gaps = 8
   align_len = 295
        qseq = ATGCAGCAGACCTATGACATGTGGCT-AAAGAAACACAATCCTGGGAAGCCTGGAG-AGGGAACA
        hseq = ATGCAGCAGACCTATGACATGTGGCTGAAA-AAACACAACCCAGGAAAGCCTGGAGAAGGGACCC
     midline = |||||||||||||||||||||||||| ||| |||||||| || || |||||||||| ||||| |

• 98 views • link

updated 3.5 years ago by Ram

• written 13.3 years ago by Pierre Lindenbaum

Hi Pierre,

This is a great example of using xslt for converting blast output which has been saved as XML and then save it in sqlite3. However, I am looking for a way not to save the blast output at all. My application is web based, so it creates its own peculiar issues for saving on the server and then transforming. I would rather get the output directly into a Perl string variable.

Thanks

• 0 views • link

written 13.3 years ago by Curious Mind •

Hi,

The trick is to print everything to a scalar ref.

For instance:

use 5.16.0;
use warnings;
use autodie;
use Data::Dumper;

use Bio::Tools::Run::RemoteBlast;
use strict;
my $prog = 'blastp';
my $db   = 'swissprot';
my $e_val= '1e-10';
my $output; #result will be printed here

my @params = ( '-prog' => $prog,
            '-data' => $db,
            '-expect' => $e_val,
            '-readmethod' => 'SearchIO' );

my $factory = Bio::Tools::Run::RemoteBlast->new(@params);

my $str = Bio::SeqIO->new(-file=>'test.fas' , -format => 'fasta' );

while (my $input = $str->next_seq()){

    my $r = $factory->submit_blast($input);
        while ( my @rids = $factory->each_rid ) {
            foreach my $rid ( @rids ) {
                my $result = $factory->retrieve_blast( $rid );
                if ( ref( $result )) {
                    my $output   = $result->next_result();
                    $factory->save_output( \$output ); #NOTE how a scalar ref is passed as a parameter, instead of a filename string.
                    $factory->remove_rid( $rid );
                    print "Result:",$output->query_name(),"\n";
                }
            }
        }
}
say $output; #print result to STDOUT

• 0 views • link

updated 3.5 years ago by Ram

• written 12.8 years ago by jing •