This is a test version of Biostars. For the public version, visit https://www.biostars.org.
Error While Running Trinity Rna-Seq Assembler

hello everyone, I am trying to run Trinity RNA-seq Assembler and has succesfully run the sample data. However, while running our data which is single-end reads in fasta format I am getting an error as "warn: Bad character in sequence". can anyone please tell me what's the issue.

thanks, Jyoti

trinity rna-seq
• 4,302 views • link
updated by Shaojiang Cai Shaojiang Cai • written by pjyoti29 • pjyoti29

could you post two or three example sequences from the fasta file?

• 1 views • link
written by skymningen skymningen

I have sequences in fasta format. Here are some of the example..

No_name GAAACAGGAAGGCATGGGTAG No_name ATCATATACGTTAGCCGAGCT No_name AAGATGAAGCAATGCACTTTCGTGT No_name CTATCTCAGGGATCATTAGTA

thanks, Jyoti

• 0 views • link
written by pjyoti29 • pjyoti29

I guess the formatting messed it up, because they should look more like this:

>No_name
GAAACAGGAAGGCATGGGTAG
>No_name
ATCATATACGTTAGCCGAGCT
>No_name
AAGATGAAGCAATGCACTTTCGTGT
>No_name
CTATCTCAGGGATCATTAGTA
• 1 views • link
written by skymningen skymningen

oh yeah...the sequence format is exactly what you have posted...there was mistake in the format in my earlier post...I am sorry for that....

• 0 views • link
written by pjyoti29 • pjyoti29

Are there any Ns in your sequences?

• 0 views • link
written by skymningen skymningen

1 answer

  1. Your FASTA file may be not well formatted. You can find some validator or write a simple script to check whether some characters are not correct. For example, sequence can not contain spaces (e.g. ”akninkslsa lgnvisalae" is not valid). Anyway, it is just a text format, you can manipulate it freely.

  2. Double check your running command, make sure your input file parameter is correct.

• 0 views • link
written by Shaojiang Cai Shaojiang Cai

Log in to answer this question.

More posts like this