Extracting Multiple Sequences Files From Large Fasta Text Using Java

Question

[J.Ashley]

Hi I really need some help with my second problem . I have a large fasta file that contains over 300 sequences. I need to search each sequence in the fasta file that contains the following zinc fingers consensus sequence of C-x2-C-x15-C-x2-C or in other words... C-(then 2 letters of any type)-C-( then 15 letters of any type)-C-(2 letters of any type)-C

In the output file i need to print out the title line, the zinc finger and followed by the sequence itself.

Here is what I have so far

import java.io.*;
import java.util.*;
public class test {
public static void main(String[] args) throws IOException {

    String fileName = ""; 
    Scanner input = new ScannerSystem.in);    

    System.out.print ("Enter the name of the sequence file: ");
    fileName = input.nextLine();
    int count = 0;
    BufferedReader bf = null;        
    try {            
        bf = new BufferedReader(new FileReader(fileName));
        String line;
        while ((line = bf.readLine()) != null){
            // if is the title line, count as a record
            if (line.matches("^>.*"))count++;
        }                
    } catch (FileNotFoundException e) {
        System.out.println("File: " + fileName + " does not exist!");
    } finally {
        if (bf != null) {
            bf.close();
        }

After this i get completely confused I know to print out sequences within the file but i have no idea how to print out the type of sequences above. Any help is greatly appreciated

Answer 1

[Pierre Lindenbaum]

Here is my Satureday-Night-Fever solution.

public class Biostar68459
    {
    public static void main(String args[]) throws java.io.IOException
        {
        java.util.regex.Pattern pattern = java.util.regex.Pattern.compile("[Cc].{2}[Cc].{15}[Cc].{2}[Cc]");
        StringBuilder name=new StringBuilder();
        StringBuilder sequence=new StringBuilder();

        for(;;)
            {
            int c=System.in.read();
            switch(c)
                {
                case -1:
                case '>':
                    {
                    if(pattern.matcher(sequence).find())
                        {
                        System.out.print(">"+name);
                        for(int i=0;i< sequence.length();++i)
                            {
                            if(i%60==0) System.out.println();
                            System.out.print(sequence.charAt(i));
                            }
                        System.out.println();
                        }
                    if(c==-1) return;
                    name.setLength(0);
                    sequence.setLength(0);
                    while((c=System.in.read())!=-1 && c!='\n') name.append((char)c);
                    break;
                    }
                case '\n':
                case ' ':
                case '\r':  break;
                default: sequence.append((char)c);break;
                }
            }
        }
    }

.

$ curl -s  "http://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=475808216&rettype=fasta" | java Biostar68459  | head
>gi|475808216|ref|NM_001277403.1| Homo sapiens zinc finger protein 730 (ZNF730), mRNA
AATCAGGCCCGCAGCTGGAGCAGACAGGGCGGCTTCCGGGATTTGGCGCGGCCTTTGTTT
CTCGCTGCCGCCGAAGCTCCAATTTTCGTCTGTCTGCTTTGTGTCCTCTGCACGTAGAAG
CCCAGCCTGTGTGGCCCTGCGACCTGCGGGTATTGGGAGATCCACAGCTAAGACGCCAGG
GCCCCCTGGAAGCCTAGAAATGGGAGCGTTGACATTTAGAGATGTGGCCATAGAATTCTC
TCTGGAGGAGTGGCAATGTCTGGACACCGAACAACAGAATTTATATAGAAATGTAATGTT
AGATAACTACAGAAACCTGGTCTTCCTGGGTATTGCTGTCTCAAAGCCAGACCTGATCAC
CTGTCTGGAGCAAGAAAAAGAGCCTTGGAATTTGAAGACACATGATATGGTAGCCAAACC
CCCAGTTATATGTTCTCATATTGCCCAAGACCTTTGGCCAGAGCAAGGCATAAAAGATTA
TTTCCAAGAAGTCATACTGAGACAATATAAAAAATGTAGACATGAGAATTTACTGTTAAG

[matted]

You're a generous person! Maybe I'm too pessimistic, but this question really sounds like a homework problem, and the "what I have so far" really seems like skeleton code from a problem statement.

I would've just given vague pointers to consider using regular expressions, since even that tidbit wasn't present in the question.

But maybe I'm wrong...

[Pierre Lindenbaum]

You're right. But he provided a source code as if he really tried to solve the problem and ... I was looking for something funny to do before switching off my laptop :-)

[J.Ashley]

Aghhh I see so you use the compile method!. Thank you so much for your help. I will try this out..test it and see what happens. Again thanks, sometimes it just takes an example to get you going!!