Hi I really need some help with my second problem . I have a large fasta file that contains over 300 sequences. I need to search each sequence in the fasta file that contains the following zinc fingers consensus sequence of C-x2-C-x15-C-x2-C or in other words... C-(then 2 letters of any type)-C-( then 15 letters of any type)-C-(2 letters of any type)-C
In the output file i need to print out the title line, the zinc finger and followed by the sequence itself.
Here is what I have so far
import java.io.*;
import java.util.*;
public class test {
public static void main(String[] args) throws IOException {
String fileName = "";
Scanner input = new ScannerSystem.in);
System.out.print ("Enter the name of the sequence file: ");
fileName = input.nextLine();
int count = 0;
BufferedReader bf = null;
try {
bf = new BufferedReader(new FileReader(fileName));
String line;
while ((line = bf.readLine()) != null){
// if is the title line, count as a record
if (line.matches("^>.*"))count++;
}
} catch (FileNotFoundException e) {
System.out.println("File: " + fileName + " does not exist!");
} finally {
if (bf != null) {
bf.close();
}
After this i get completely confused I know to print out sequences within the file but i have no idea how to print out the type of sequences above. Any help is greatly appreciated
•
written
by
J.Ashley •
Here is my Satureday-Night-Fever solution.
public class Biostar68459
{
public static void main(String args[]) throws java.io.IOException
{
java.util.regex.Pattern pattern = java.util.regex.Pattern.compile("[Cc].{2}[Cc].{15}[Cc].{2}[Cc]");
StringBuilder name=new StringBuilder();
StringBuilder sequence=new StringBuilder();
for(;;)
{
int c=System.in.read();
switch(c)
{
case -1:
case '>':
{
if(pattern.matcher(sequence).find())
{
System.out.print(">"+name);
for(int i=0;i< sequence.length();++i)
{
if(i%60==0) System.out.println();
System.out.print(sequence.charAt(i));
}
System.out.println();
}
if(c==-1) return;
name.setLength(0);
sequence.setLength(0);
while((c=System.in.read())!=-1 && c!='\n') name.append((char)c);
break;
}
case '\n':
case ' ':
case '\r': break;
default: sequence.append((char)c);break;
}
}
}
}
.
$ curl -s "http://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nucleotide&id=475808216&rettype=fasta" | java Biostar68459 | head
>gi|475808216|ref|NM_001277403.1| Homo sapiens zinc finger protein 730 (ZNF730), mRNA
AATCAGGCCCGCAGCTGGAGCAGACAGGGCGGCTTCCGGGATTTGGCGCGGCCTTTGTTT
CTCGCTGCCGCCGAAGCTCCAATTTTCGTCTGTCTGCTTTGTGTCCTCTGCACGTAGAAG
CCCAGCCTGTGTGGCCCTGCGACCTGCGGGTATTGGGAGATCCACAGCTAAGACGCCAGG
GCCCCCTGGAAGCCTAGAAATGGGAGCGTTGACATTTAGAGATGTGGCCATAGAATTCTC
TCTGGAGGAGTGGCAATGTCTGGACACCGAACAACAGAATTTATATAGAAATGTAATGTT
AGATAACTACAGAAACCTGGTCTTCCTGGGTATTGCTGTCTCAAAGCCAGACCTGATCAC
CTGTCTGGAGCAAGAAAAAGAGCCTTGGAATTTGAAGACACATGATATGGTAGCCAAACC
CCCAGTTATATGTTCTCATATTGCCCAAGACCTTTGGCCAGAGCAAGGCATAAAAGATTA
TTTCCAAGAAGTCATACTGAGACAATATAAAAAATGTAGACATGAGAATTTACTGTTAAG
You're a generous person! Maybe I'm too pessimistic, but this question really sounds like a homework problem, and the "what I have so far" really seems like skeleton code from a problem statement.
I would've just given vague pointers to consider using regular expressions, since even that tidbit wasn't present in the question.
But maybe I'm wrong...
You're right. But he provided a source code as if he really tried to solve the problem and ... I was looking for something funny to do before switching off my laptop :-)
Aghhh I see so you use the compile method!. Thank you so much for your help. I will try this out..test it and see what happens. Again thanks, sometimes it just takes an example to get you going!!
Aghhh I see so you use the compile method!. Thank you so much for your help. I will try this out..test it and see what happens. Again thanks, sometimes it just takes an example to get you going!!
this should be a comment. Not a new answer.
Log in to answer this question.
